A multilayer perceptron (MLP) neural network in Perl
...IS THE MAIN PROGRAM ************************** #============================================================== sub main { # initiate the weights initWeights(); # load in the d...2973 days ago
2967 days ago
Blast result parser with Perl and Bioperl
...ength, description, E value, bit score, query frame, query sta...GV != 3); my ($infile,$numHits,$outfile) = @ARGV; print "P...gth; # output "no hits found" if there is no hits...the start and the end of the hit sequence in the alignment...2971 days ago
Find and replace ambiguous characters in fasta file with Perl and Bioperl
..."Print out the name of sequences with characters other than ATGC-....ambiguous characters are repleced with the\n". "specified char...If no \n". "argument is given, it will take STDIN as the input\...each my $s (@seqArr) { $seqOut->write_seq($s); } } exit;...2971 days ago
Perl program to implement sliding window !
#!/usr/bin/perl -w my $filename = 'data.txt'; open(my TR, '2971 days ago
2971 days ago
Perl to print indivisual nucleotide from a sequence!
#!/usr/bin/perl use strict; use warnings; my $string = "ATGCTTGCGT?AAATG??CT?GCGTA"; my @chars = split("", $string); print "First character: $chars[0]\n";2971 days ago
2966 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2966 days ago
Generating a random string with Perl
#!/usr/bin/perl # This function generates random strings of a given length sub generate_random_string { my $length_of_randomstring=shift;# the length of...2964 days ago