Results for "Programming with Perl"

Bio-Scripts

  • Perl6 script to count ATGC !

    use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v6

    1611 days ago

  • Perl subroutine for Kmer !

    sub kmers { my $seq = shift or return; my $len = length $seq; my @kmers; for (my $i = 0; ($i + $KMER_SIZE)

    1609 days ago

  • Bash command to install bwa, samtools, picard !

    (base) [wsu29@bladeamd-2 tmp]$ conda install bwa Collect...d | h7b6447c_3 3.7 MB perl-5.26.2 |...bioconda/linux-64::bwa-0.7.17-hed695b0_7 perl pkgs/main/linux...

    1607 days ago

  • Perl script to delete the adjacent repeats !

    /usr/bin/perl #Mostly the interview question for bioinfomatician ! #Write a code to delete the adjacent repeated character .... $string='ATTTTTTGGC'; # This should...

    1602 days ago

  • Install gnuplot in Ubuntu !

    $MT:~/Downloads/cgr-perl$ sudo apt-get install gnuplot [sudo] password for jit: Reading package lists... Done Building dependency tree Reading state information... D...

    1593 days ago

  • Install vcftools on Ubuntu

    jit@jit-HP-Pro-3335-MT:~/Downloads/annotated$ sudo apt in...buntu0.1) ... #MORE at https://vcftools.github.io/perl_module.html # Calculate st.../NA00001/DP=1:200 -p out/ vcf-stats file.vcf.gz > perl.dump

    1577 days ago

  • Uninstall a perl module !

    # uninstall_perl_module.pl from PerlTricks.com use 5...Name passed as an argument. E.G.\n\t perl $0 Module::Name\n") unless $#...try to delete every file associated with the module foreach my $file...not remove $dir: $!\n"; } #Run #perl uninstall_perl_module.pl Bio:...

    1566 days ago

  • Perl script to reads and extract webpage contents !

    use 5.010; use strict; use warnings; use WWW::Mechanize; my ($url) = @ARGV; die "Usage: $0 URL\n" if not $url; my $w = WWW::Mechanize->new; $w->get($url); say $w->content; #Run #jit@jit-HP-Pro-3335-MT:~/Downloads/testDock$ perl web.pl https://bioinformaticsonline.com

    1565 days ago

  • Pack a perl program with their dependencies on Ubuntu !

    #Follow steps to create your own executab...d package libmodule-signature-perl. Preparing to unpack .../2-l...analyzingcodonusage perl script analyzing codon usage...rison of the fruit fly genome with the human genome reveals that...ia Importance for Researchers With Benefits to the Strategy !By...

    1563 days ago

  • Commands to install Statistics::R module in Ubuntu !

    $ sudo apt-get install libstatistics-r-perl Reading package lists... Done B...be installed: libstatistics-r-perl r-base r-base-html 0 upgrade...ic/universe amd64 libstatistics-r-perl all 0.24-1 [23.3 kB] Get:3 h...nselected package libstatistics-r-perl. Preparing to unpack .../lib...

    1563 days ago