Results for "perl"
Bio-Scripts
use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v61603 days ago
- sub kmers { my $seq = shift or return; my $len = length $seq; my @kmers; for (my $i = 0; ($i + $KMER_SIZE)
1601 days ago
Bash command to install bwa, samtools, picard !
...B openssl-1.1.1d | h7b6447c_3 3.7 MB perl-5.26.2 |...py37_0 bwa bioconda/linux-64::bwa-0.7.17-hed695b0_7 perl pkgs/main/linux...1599 days ago
Perl script to delete the adjacent repeats !
/usr/bin/perl #Mostly the interview question for bioinfomatician ! #Write a code to delete the adjacent repeated character .... $string='ATTTTTTGGC'; # This should...1594 days ago
- $MT:~/Downloads/cgr-perl$ sudo apt-get install gnuplot [sudo] password for jit: Reading package lists... Done Building dependency tree Reading state information... D...
1585 days ago
- ...for man-db (2.8.3-2ubuntu0.1) ... #MORE at https://vcftools.github.io/perl_module.html # Calculate st...ile.vcf.gz -f SAMPLE/NA00001/DP=1:200 -p out/ vcf-stats file.vcf.gz > perl.dump
1569 days ago
- # uninstall_perl_module.pl from PerlTricks.com use 5.14.2; use ExtUtils::Instal...o Module::Name passed as an argument. E.G.\n\t perl $0 Module::Name\n") unless $#...rn "could not remove $dir: $!\n"; } #Run #perl uninstall_perl_module.pl Bio:...
1558 days ago
Perl script to reads and extract webpage contents !
use 5.010; use strict; use warnings; use WWW::Mechanize; my ($url) = @ARGV; die "Usage: $0 URL\n" if not $url; my $w = WWW::Mechanize->new; $w->get($url); say $w->content; #Run #jit@jit-HP-Pro-3335-MT:~/Downloads/testDock$ perl web.pl https://bioinformaticsonline.com1557 days ago
Pack a perl program with their dependencies on Ubuntu !
...talled: libgetopt-argvfile-perl libmodule-scandeps-perl libmo...erse amd64 libmodule-scandeps-perl all 1.24-1 [28.6 kB] Get:3 h...d package libmodule-signature-perl. Preparing to unpack .../2-l...analyzingcodonusage perl script analyzing codon usage...1555 days ago
Commands to install Statistics::R module in Ubuntu !
...do apt-get install libstatistics-r-perl Reading package lists... Don...l be installed: libstatistics-r-perl r-base r-base-html 0 upgrade...nic/universe amd64 libstatistics-r-perl all 0.24-1 [23.3 kB] Get:3 h...unselected package libstatistics-r-perl. Preparing to unpack .../lib...1555 days ago
