Perl script for chi-squared test !
...$file2_ob{$di}; $total += ($file1_ob{$di} + $file2_ob{$di}); } # now calculate expected values...intf("%.2f",(($file1_ob{$di}+$file2_ob{$di}) * $row2) / $total); } # now calculate chi-squared values...473 days ago
Download lumpy skin disease data !
Location https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=880745 The raw genome sequence data from the 2022 outbreak in India is available in the SRA Project PRJNA880745472 days ago
Python script to convert Multi-line Fasta to Single-line Fasta
...me} to {output_filename} in single-line FASTA format.") except FileNotFoundError: print(f"Error: File '{input_filename}' not found.") # Example usage:...157 days ago
Perl script to convert Multi-line Fasta to Single-line Fasta !
...multi_to_single_line_fasta { my ($input_filename, $output_filename) = @_; open my $input_file, '', $output_filename or die "Error: Could not open file '$output_filename'...157 days ago
156 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
...; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.gff'; my $genome_fasta = 'path/to/your/genom...156 days ago
Raku script to find repeats in sequences !
...); } } return @repeats; } # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-repeats($genome-sequence); say "Repeats...156 days ago
Python script to find repeats in the DNA sequence !
...length] if sequence.count(substring) > 1 and substring not in repeats: repeats.append(substring) return repeats # Example usage genome_sequence = "ATCGATCGATCGATC...156 days ago
Raku script to find microsatellites in DNA fragments !
...} return @microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genome-sequence); say "Microsat...156 days ago
Perl script to parse VCF file !
#!/usr/bin/perl use strict; use warnings; # Usage: ./parse_vcf.pl input.vcf die "Usage: ./parse_vcf.pl input.vcf\n" unless @ARGV; my $vcf_file = shift @A...156 days ago