Download lumpy skin disease data !
Location https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=880745 The raw genome sequence data from the 2022 outbreak in India is available in the SRA Project PRJNA880745462 days ago
146 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.gff'; my $genome_fasta = 'path/to/your/genome.f...146 days ago
Raku script to find repeats in sequences !
...); } } return @repeats; } # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-repeats($genome-sequence); say "Repeats fo...146 days ago
Raku script to find microsatellites in DNA fragments !
...} return @microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genome-sequence); say "Microsatel...146 days ago
Perl script to calculate the basic stats of the assembled genome !
...warnings; use Bio::SeqIO; # Input file containing the genome assembly in FASTA format my $input_file = 'genome_assembly.fasta'; # Create...# Print the computed statistics and information print "Genome Assembly Statistics:\n"; pri...146 days ago
Python script for basic stats of the assembled genome !
...ort SeqIO import statistics # Input file containing the genome assembly in FASTA format input_file = 'genome_assembly.fasta' # Variable...# Print the computed statistics and information print("Genome Assembly Statistics:") print...146 days ago
Python script to calculate basic genome stats !
...m Bio import SeqIO def calculate_genome_stats(fasta_file): # Initialize variables to store genome statistics genome_length...g_count = 0 # Read the genome sequence from the FASTA file...ntent gc_content = (gc_count / genome_length) * 100 if genome_lengt...16 days ago