Download lumpy skin disease data !
Location https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=880745 The raw genome sequence data from the 2022 outbreak in India is available in the SRA Project PRJNA880745453 days ago
137 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.gff'; my $genome_fasta =...137 days ago
Raku script to find repeats in sequences !
sub find-repeats($sequence, $min-repeat-length = 3) { my @repeats; for ^($...return @repeats; } # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-repeats($genome-sequenc...137 days ago
Raku script to find microsatellites in DNA fragments !
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $m...icrosatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genome-sequenc...137 days ago
Perl script to calculate the basic stats of the assembled genome !
#!/usr/bin/perl use strict; use warnings; use Bio::SeqIO; # Input file containing the genome assembly in FASTA format my $input_file = 'genome_assembly.fasta'; # Create Bio::SeqIO object t...the computed statistics and information print "Genome Assembl...137 days ago
Python script for basic stats of the assembled genome !
from Bio import SeqIO import statistics # Input file containing the genome assembly in FASTA format input_file = 'genome_assembly.fasta' # Variables for computing statistic...Print the computed statistics and information print("Genome Assembl...137 days ago
Python script to calculate basic genome stats !
from Bio import SeqIO def calculate_genome_stats(fasta_file): # Initialize variables to store genome statistics genome_length = 0...0 g_count = 0 # Read the genome sequence from the FASTA file...content gc_content = (gc_count / genome_length)...7 days ago