Genome Scaffolding and gap filling !
scaffolding with ARCS v1.0.3 (−c3, −l,4, −a,0.9, −z500, −m50, −20 000, −e30000, −s90). https://github.com/bcgsc/arcs Next, automated gap filling was performed using Sealer v2.0.1 (−L150, -P10, −k75-115 [step = 10]) https://github.com/bcgsc/abyss/tree/sealer-release664 days ago
Identify genome-wide synteny with LASTZ alignment
#This is the walkstrough how to identifiy genome-wide synteny markers based on LASTZ alignment. Step1:Mask the repeat sequences for both genomes...561 days ago
Perl script to find inverted repeats !
#!/usr/bin/perl use strict; use warnings; use Bio::SeqIO; use Bio::Tools::Run::RepeatMasker; my $genome_file = "genome.fasta"; # read genome sequ...:RepeatMasker->new(); my $rm_report = $rm->run($genome_f...469 days ago
Download lumpy skin disease data !
Location https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=880745 The raw genome sequence data from the 2022 outbreak in India is available in the SRA Project PRJNA880745454 days ago
138 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.gff'; my $genome_f...138 days ago
Raku script to find repeats in sequences !
sub find-repeats($sequence, $min-repeat-length = 3) { my @repeats; for ^($s...return @repeats; } # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-repeats($genome-s...138 days ago
Raku script to find microsatellites in DNA fragments !
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $mi...microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genome-s...138 days ago
Perl script to calculate the basic stats of the assembled genome !
...IO; # Input file containing the genome assembly in FASTA format my $input_file = 'genome_assembly.fasta'; # Create Bio::SeqI...erate through each sequence in the assembly while (my $seq = $seqio->nex...statistics and information print "Genome Assembly Statistics:\n"; print "-----...138 days ago
Python script for basic stats of the assembled genome !
...ics # Input file containing the genome assembly in FASTA format input_file = 'genome_assembly.fasta' # Variables for com...erate through each sequence in the assembly for record in SeqIO.parse(in...statistics and information print("Genome Assembly Statistics:") print("-------...138 days ago