Comment on "Indexcov: fast coverage quality control for whole-genome sequencing"
Installing goleft ➜ falconUnzip_assembly bioconda install goleftzsh: command not found: bioconda➜ falconUnzip_assembly con...8-1 bioconda The following packages will be UPDATED: ca-cer...###### | 100% Preparing transaction: doneVerifying transactio...2312 days ago
Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
Bioinformatics jobs in Spain http://genome.crg.es/main/joboffers.php2316 days ago
Comment on "HALC: High throughput algorithm for long read error correction"
...Inputs Long reads in FASTA format. Contigs assembled from the corresponding short reads in FA...(only for -ordinary mode; obtained with cat left_reads.fa >short_rea...Using AlignGraph runHALC.py long_reads.fa contigs.fa [-options|-options]...2327 days ago
2335 days ago
Comment on "Nanopolis: polish a genome assembly"
# Index the draft genome bwa index draft.fa # Align the basecalled reads to the draft sequence bwa mem -x ont2d -t 8 draft.f...el --results nanopolish.results -P 8 \ nanopolish variants --consensus -o polished.{1}.vcf -...2335 days ago
Comment on "Installing Porechop on Ubuntu !"
➜ MyPassport porechop -i /media/urbe/MyDDrive/ON...76.7 1D^2 part 2 91.2 80.6 Barcode 1 (reverse) 76.0 78.6 Barc...code 5 (forward) 75.0 75.0 Barcode 6 (forward) 76.9 76.9 Barc...ode 37 (forward) 80.0 80.0 Barcode 38 (forward) 76.0 80.8 Bar...t: CTTCGTTCAGTTACGTATTGCTGGCGTCTGCTT 1D2_part_2_end: CACCCAAG...2342 days ago
Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
Bioinformatics jobs at https://www.monster.com/jobs/search/?q=Bioinformatics&intcid=skr_navigation_nhpso_searchMain&jobid=1985086042342 days ago
Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
EUROPE EURAXESS https://euraxess.ec.europa.eu/site/search?keywords=bioinformatics2348 days ago
Comment on "Interview Puzzles for Bioinformatician !"
Here is the list of puzzles which are asked these days in the Interview Ant and Triangle Problem Crossing the Bridge Puzzle Bur...er Puzzle Heaven or Hell Puzzle 10 Coins Puzzle King and Wine Bot..., it has lots of puzzles. Puzzles Archives - GeeksforGeeks2355 days ago
Comment on "Various scholarships around the world !!"
Young Scientist Fellowship, Korea 1. Purpose and Background With the vision of "Making Discoveries for Humanity and Socie...," the Institute for Basic Science (IBS) was founded in...aborations with leading researchers.We hope that the YS...2355 days ago
