Results for "AI"
Bio-Scripts
Bash script to download SRA file !
#We can use the sratoolkit to directly pull the sequence data (in paired FASTQ format) from the archive. f...mand ensures we get two files, one for the first and second mate in each pair. We'll use them in this form...1561 days ago
Bash script to alignment of short reads against reference genome !
....gz --- this just specifies the base reference file name (bwa finds the indexes using this) and the input alignment files. The first file should contain the first mate, the second f...1561 days ago
- use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v6
1561 days ago
Bash commandline to install Anaconda !
....8.3-py37h14c3975_0 ... installing: boto-2.49.0-py37_0 ... installing: cairo-1.14.12-h8948797_3 ... ins...... installing: snowballstemmer-1.2.1-py37_0 ... installing: sortedcontainers-2.1.0-py37_0 ... install...1557 days ago
Bash command to install Miniconda !
...6.130.3|:443... connected. HTTP request sent, awaiting response... 200 OK Lengt...dded / updated specs: - _libgcc_mutex==0.1=main - asn1crypto==1.2.0=py3...will be INSTALLED: _libgcc_mutex pkgs/main/linux-64::_libgcc_mutex-0.1-...1557 days ago
Bash command to install bwa, samtools, picard !
...LLED: _anaconda_depends pkgs/main/linux-64::_anaconda_depends-...695b0_7 perl pkgs/main/linux-64::perl-5.26.2-h14c39...LLED: bzip2 pkgs/main/linux-64::bzip2-1.0.8-h7b644...ondar_1 binutils_impl_lin~ pkgs/main/linux-64::binutils_impl_linu...1557 days ago
Bash command to install GATK, Bedtools and SnpEff !
...e following NEW packages will be INSTALLED: certifi pkgs/main/linux-64::certifi-2019.11.28...atk bioconda/noarch::gatk-3.8-7 pip pkgs/main/linux-64::pip-20.0.2-py38_1...1557 days ago
- ...load.nvidia.com)|192.229.232.112|:443... connected. HTTP request sent, awaiting response... 200 OK Lengt...nload.nvidia.com)|192.229.232.112|:80... connected. HTTP request sent, awaiting response... 200 OK Lengt...
1555 days ago
- ...4df9-1ubuntu1 [265 kB] Get:2 http://in.archive.ubuntu.com/ubuntu bionic/main amd64 javascript-common all...all 0.8.0-3 [25.4 kB] Get:4 http://in.archive.ubuntu.com/ubuntu bionic/main amd64 libjs-jquery all 3.2.1...
1555 days ago
- ...t to continue? [Y/n] Y Get:1 http://in.archive.ubuntu.com/ubuntu bionic/main amd64 libjs-angularjs all 1.5.10-1 [506 kB] Get:2 http://in.archive.ubuntu.com/ubuntu bionic/main amd64 libtommath1 amd64 1.0....
1553 days ago
