Understating pacbio reads name !
...on of RS) Part Number (usually "p0", "X0" when using expired reagents) ZMW hole number Subread Region (start_stop using polymerase read coordinates) readScore barcodeScore...1987 days ago
3006 days ago
3006 days ago
2148 days ago
Next generation sequencing in R or bioconductor environment
...ata Visualization ggbio: ggplot2 extension for genomics data (online manual) Gviz: Plotting data and annotation information along genomic coordinates HilbertVis: Hilbert genome pl...3622 days ago
List of Bioinformatics Software Tools for Next Generation Sequencing
...s, transcripts, and protein sequence; uses SIFT and PolyPhen Input: Coordinates of variants and nucleotide ch...:Passenger mutation rates, Transcript and amino acid change, Genomic coordinates Output: CHASM score, p-value...2906 days ago
3818 days ago
Blast script to index and extract sequence !!
...GCAGCTTCTGAACTG GTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGAC .... # query the blast database by id and coordinates $ blastdbcmd -db EC -range 1...2849 days ago
Transpose the file coordinates and plot dendrogram in R
#Save this as tr.awk { for (i=1; i2614 days ago
Comment on "Sibelia: A comparative genomics tool"
...ia" produces following files: 1. Blocks coordinates 2. Genomes represented as pe...s are described below in details. Blocks coordinates ------------------ File nam...ted. Other fields are described in section "Coordinates file". Sequences of synteny...1282 days ago
1517 days ago