BOL: Results for "Coordinates"

Results for "Coordinates"

- BioJoker@biojoker
Understating pacbio reads name !
...on of RS) Part Number (usually "p0", "X0" when using expired reagents) ZMW hole number Subread Region (start_stop using polymerase read coordinates) readScore barcodeScore...
1985 days ago

- Jitendra Narayan@admin
liftover
Convenient conversions between genome assemblie. The liftover package makes it easy to remap genomic coordinates to a different genome assembly. More at https://github.com/aaronwolen/liftover https://www.bioconductor.org/help/workflows/liftOver/
3003 days ago
- Jitendra Narayan@admin
CrossMap
...program for convenient conversion of genome coordinates (or annotation files) between...F. CrossMap is designed to liftover genome coordinates between assemblies. It’...recommend using CrossMap to convert genome coordinates between species. More at htt...
3003 days ago
+15 more Bookmarks

- Jit@jit.aber
Download blasr 1.3 version
...:47 2018] Building bwa index...bwa index -p all_p_ctg.fa /home/urbe/Tools/OPERA-LG_v2.0.6/all_p_ctg.fa[Thu Jun 14 18:18:35 2018] Finding the SA coordinates of the reads using BWA aln......
2146 days ago

- John Parker@parker
Next generation sequencing in R or bioconductor environment
...ata Visualization ggbio: ggplot2 extension for genomics data (online manual) Gviz: Plotting data and annotation information along genomic coordinates HilbertVis: Hilbert genome pl...
3619 days ago
- Jitendra Prajapati@jprajapati81
List of Bioinformatics Software Tools for Next Generation Sequencing
...s, transcripts, and protein sequence; uses SIFT and PolyPhen Input: Coordinates of variants and nucleotide ch...:Passenger mutation rates, Transcript and amino acid change, Genomic coordinates Output: CHASM score, p-value...
2903 days ago

- Jit@jit.aber
Convert a SAM file to tab-delimited alignment coordinates https://gist.github.com/sjackman/7016520 #SAM #BAM #Convert #Tab
2616 days ago
- Jit@jit.aber
Get the fasta sequence of the coordinates http://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html #Fasta #Bed #Coordinates #Bedtools
2610 days ago
+1 more Wire posts

- Archana Malhotra@archana
Why neuroinformatics?
...imago (http://vimago.se/en) About INCF The International Neuroinformatics Coordinating Facility (INCF), together with its 17 member countries, coordinates collaborative informatics inf...
3816 days ago

- Shruti Paniwala@shruti
Blast script to index and extract sequence !!
...GCAGCTTCTGAACTG GTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGAC .... # query the blast database by id and coordinates $ blastdbcmd -db EC -range 1...
2847 days ago
- Abhimanyu Singh@abhimanyu
Transpose the file coordinates and plot dendrogram in R
#Save this as tr.awk { for (i=1; i
2612 days ago
+3 more Bio-Scripts

- BioStar@biostar
Comment on "Sibelia: A comparative genomics tool"
...ia" produces following files: 1. Blocks coordinates 2. Genomes represented as pe...s are described below in details. Blocks coordinates ------------------ File nam...ted. Other fields are described in section "Coordinates file". Sequences of synteny...
1280 days ago
- Jit@jit.aber
Comment on "ASCIIGenome: genome browser based on command line interface and designed for running from console terminals."
...nbsp; Move to the next feature not overlapping the current coordinates. ...
1515 days ago
+1 more Comments