Results for "Count"
Bio-Scripts
Installing Platypus on Ubuntu !
...^~~~~~~~~~~~~~ tabix/bgzf.c.pysam.c: In function ‘bgzf_close’: tabix/bgzf.c.pysam.c:632:8: warning: variable ‘count’ set but not used [-Wunused-but-set-variable] int count, block_length = deflate_block...2023 days ago
Finding Kmers from fasta sequence file
Save it in sample.fa >test TAATGCCATGGGATGTT jellyfish count -m 3 -s 100000 sample.fa -o sample.jf jellyfish dump -c sample.jf It return TGT 1 GAT 1 GGG 1 GGA 1 CAT 1 TGC 1 TAA 1 GCC 1 CCA 1 GTT 1 TGG 1 ATG 3 AAT 11976 days ago
Perl script to count occurrence of a character !
...bin/perl use strict; use warnings; my %count_of; while ( ) { my @v...it "\t", $_; #my ( $word) = m/(\w+)/; $count_of{$val[13]}++; } foreach...f{$b} } keys %count_of ) { print "$word\t$count_of{$word}\n"; }1904 days ago
Perl script to run in parellel !
...esses ) { $pm->start and next; my $count = 0; foreach my $chr_set (keys %genome) { $count++; if ( ( $count % $...my $len = $gene_info->length; my $GCcount = $sequence =~ tr/GC|gc//;...1690 days ago
Samtools commands for bioinformatician !
## count mapped reads samtools view -c -F 260...ools -F 4 sal_sej.bam | less ### count reads (-c) by flag specified...ool view -c -f 4 sal_sej.bam ### count reads by quality value specif...verage_results.txt ### note: returns count of depth at each position. in...1607 days ago
- use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v6
1563 days ago
Tadpole is 250x faster than SPADes assembler !
...Write kmers and their counts. fastadump=t Write...to a positive integer, use a countmin sketch...Error correct via kmer counts. reassemble=t If ecc...to kmer-counting, and again prior to correc...980 days ago
- ...dual words or pieces called fields. #NR: NR command keeps a current count of the number of input record...statements once for each record in a file. #NF: NF command keeps a count of the number of fields withi...
898 days ago
Run Pango on your multifasta file !
...ed hash: /home/jnarayan/anaconda3/envs/pangolin/lib/python3.8/site-packages/pangoLEARN/data/lineages.hash.csv Job stats: job count min threads max threads...891 days ago
Extract all fasta sequences except ids !
...number the kmers perl storeKmer.pl omi_kmer19_formated.fa > omi_kmer19_formated_numbered.fa # cat all *.rd file cat *.rd > all_reads_hits #count the lines in each file -- go...832 days ago
