Results for "DNA test"
Bio-Scripts
➜ Tools git:(master) ✗ git clone...e.am: installing './INSTALL' Tests/AdHoc/Makefile.am: installin...file config.status: creating Tests/Unit/Makefile config.status...file config.status: creating Tests/Unit/Makefile config.status...config.h.in Makefile test-driver config.log Makefil...2163 days ago
Biological Sequence handling with Perl !
package Sequence::Generic; # File: Sequence/Generic.pm use strict; use Carp; use...elf->{'type'} = $type || ($sequence=~/u/i ? 'RNA' : 'DNA'); } return $self; }...self->{'type'} = $_[0] : $self->{'type'}; } sub is_DNA...2193 days ago
Perl script to convert GFF 2 FASTA !
#!/usr/bin/perl use strict; use warnings; use Bio::Seq; use Bio::Seq...">$ARGV[2].pep.fasta" ); my $outfile_cdna = Bio::SeqIO->new( -format => 'fasta', -file => ">$ARGV[2].cdna.fasta" ); my $outfile_gene =...ending with a stop codon included) # cdna...2151 days ago
Install Parrot Virtual Machine !
#Parrot is a virtual machine designed to efficiently com...r wordsize.....little-endian. auto::va_ptr - Test the type of va_ptr..............lude gettext.............yes. auto::snprintf - Test for snprintf....................1549 days ago
- set -e echo "Running reapr version 1.0.18 pipeline:" e...----- #!/usr/bin/env bash set -e echo " test smaltmap " reapr smaltmap..._________________________________________________ test perfectmap " reapr perf...
2111 days ago
- ➜ Tools git:(master) ✗ git clone https://github.com/Nextomics/nextsv.git...ed. Using 'release' -- Try OpenMP C flag = [-fopenmp] -- Performing Test OpenMP_FLAG_DETECTED -- Performing Test OpenMP_FLAG_DETECTED - Succes...
2111 days ago
- library(vcfR) # Input the files. vcf
2072 days ago
Generates a genome coverage plot with R
library(CoverageView) ##draw a coverage plot for a test case BAM file #get a BAM test file treatBAMfile2067 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';...print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~ s/A/T/g; $rev..."Here is the reverse complement DNA: WRONG:\n\n"; print "$revc..."Here is the reverse complement DNA:...2055 days ago
- (denovo_asm) [jnarayan@hmem00 ~]$ git clone https://github.com/cdunn2001/git-sym.git fatal: destination path 'git-sym' already exists and is not an empty directory....
2046 days ago
