2077 days ago
Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2060 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =...2060 days ago
Perl script to split fasta sequence and create overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "1989 days ago
1742 days ago
Perl script to run in parellel !
#!/usr/bin/perl use strict; use warnings; use Parallel::ForkManager; use Bio::SeqIO; my ($sequence_data_ref) = parse_genome_files($ARGV[0]); my %genome=%{$seq...1703 days ago
1574 days ago
Perl One-Liner to print only non-uppercase letters
#Go through file and only print words that do not have any uppercase letters. perl -ne 'print unless m/[A-Z]/' dna.fa > dnaOnlyLowercase.fa #To lowercase everything perl -pne 'tr/[A-Z]/[a-z]/' dnaUpperCase.fa >dnawithoutuppercase.fa;1400 days ago
1357 days ago
Perl onliner to print fasta headers !
#Save all your fasta in seq.fa and run the following ... perl -ne 'print if /^>/' seq.fa #Print header with line number perl -ne 'print "$. $_" if /^>/ ' seq.fa1013 days ago