Tools to detect synteny blocks regions among multiple genomes
...have developed a language of their own. They are pouring lots of money and energy to read the entire genomic text and understand the gods own code ATGC. It is somewhat fascinating,...2603 days ago
Computer simulation of genetic mechanism !!
...r theorized variation frequency, per a given fragment size and grouped by GC content across a genome to mo...ased on user specified models. http://research.nhgri.nih.gov/gasp/ GCTA Genome-wide Complex T...2968 days ago
Various scholarships around the world !!
This page provides information on scholarships for developing countries students who are in need of scholarship to study at home and abroad. A scholar...2810 days ago
Software and Tools to detect structure variation with long reads !!
...t-read data. With Single Molecule, Real-Time (SMRT) Sequencing, you can access structural variations having a broad range of sizes, types, and GC content with the ability to:...2601 days ago
List of Research Institutes in India (Biological Sciences/ Biotechnology)
...– Biology, chemistry, math and physics Rajiv Gandhi Centre for BiotechnologyThycaud P.O., Thiruvananthapuram 695 , KeralaEmail: info@rgcb.res.inWeb: rgcb.res.in/Research Areas: Disea...2357 days ago
BBTools for bioinformatician !
...s: Code: >Read1_adapter GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG >Read2_adapt...ut=out_%_#.fq prefixmode=f names=GGACTCCT+GCGATCTA,TAAGGCGA+TCTACTCT,......0000000-A74HF:1:2110:14788:23085 ATGA=8 ATGC=6 GTCA=6 AAAT=5 AAGC=5 AATG=5...2263 days ago
Install ImageMagick from Unix Source
...de used by make... GNUchecking for gcc... gccchecking whether the C compil...nmpchecking for pthread_join using gcc -pthread ... yeschecking whe...or signed 64-bit type... signed longchecking for unsigned 64-bit ty...reating MagickWand/MagickWand-configconfig.status: creating MagickW...2139 days ago
2126 days ago
List of motif discovery tools !
In genetics, a sequence motif is a nucleotide or amino-acid sequence pattern that is widespread and has, or is conjectured to have, a biological significance. For p...1986 days ago
1828 days ago