Bash script to get intergenic region from genome files !
#For the intergenic region, we will require the size of the chromosomes. wget http://xxx.chr...mv tmp xxx.chrom.sizes gunzip -c genome_file.gtf.gz | awk 'BEGIN{OFS="\t";} $3=="gene...1368 days ago
Install and set up i-adhore for synteny and wgd analysis ! -- step by step --
#Need to download i-adhore-3.0.01.tar.gz from https://wdiceryfd4rj....6.34") -- Configuring done -- Generating done -- Build files ha...ject src/CMakeFiles/i-adhore.dir/Gene.cpp.o [ 63%] Building CXX ob...anaconda3/envs/wgd/./API/iADHoRe/gene.pm.../testset/datasetI/arath_2_3_beta/gene...1206 days ago
Commands to transfer files and folder in docker !
#To copy files between host machine and container (execute the commands on host, not inside container): $ docker cp FILE_OR_FOLDER_ON_HOST CONTAINER_ID:/CONTAINER_DIRECTORY #or $ docker cp CONTAINER_ID:FILE_OR_FOLDER_IN_CONTAINER HOST_DIRECTORY988 days ago
Inreractive SCP / File transfer !
#!/bin/bash #next line prints hearer of script echo "Interactive Script to Copy File (files) / Directory using scp" #next line check if entered value is not null, a...953 days ago
bash script to extract sequence by ids !
Use a Perl one-liner, grep and seqtk subseq to extract the desired fasta sequences: # Create test input:...BGI_novel_T016141 Solyc03g007600.3.1 ACGTACGTACGTACGTACGTACG EOF cat > gene_ids.txt ids_gene...826 days ago
Install Install Gffcompare on Ubuntu / Linux
#Gffcompare is a program that is used to perform operations on general feature format (GFF) and general transfer format (GTF) files. It has a binary distribution compatible with the linux we’re using so w...826 days ago
Bash script to transfer files to server !
# rsync options source destination rsync -azvh --progress PacBio_clean.fa xxx@xxx.xxx.res.in:/home/ # scp source_file_name username@destination_host:destination_folder scp –rpv /datafile xxx@192.168.1.100:/home/me806 days ago
302 days ago
97 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF fil.../to/your/file.gff'; my $genome_fasta = 'path/to/your/genome.fasta'; # Gene ID to extract my $gene...97 days ago