Perl script to find palindromic pattern !
#!/usr/bin/perl use strict; use warnings; use strict; my %invert; @invert{ qw[ A C G T ] } = qw[ T G C A ]; my $in = do{ local $/; }; chomp $in; print $in; for...2113 days ago
Perl script to extract sequence by Ids from multifasta file !
#!/usr/bin/perl -w use strict; my $idsfile = "$ARGV[0]"; my $seqfile = "$ARGV[1]"; my %ids = (); open FILE, $idsfile; while() { chomp; $ids{$_} += 1;...2110 days ago
2088 days ago
Perl script to extract a sequence from multifasta with range !
# filterfastarange.pl #!/usr/bin/perl use strict; use warnings; #perl filterfastarange.pl 301 600 contigs.fasta > contigs-gt300-lte600.fasta my $minlen = shift...2080 days ago
Perl script to break the contigs by 'N'
#!/usr/bin/perl -w use Bio::SeqIO; use strict; my $fasta = Bio::SeqIO->new( -file => "$ARGV[0].parts.fasta",-format=>'fasta'); open(SCAFF,">$ARGV[0].parts.scaff...2076 days ago
Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2057 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =...2057 days ago
Perl script to create a consensus of nucleotide sequences !
use strict; use warnings; my @instances = qw ( AAAAA ATCGA ATAAA ); my @instances2 = qw ( AAAAA AACGA ATAAA AGAAA AGAAA); print consensus(@instances),"\n";...2046 days ago
Installing pb-assembly on Linux !
[jnarayan@hmem00 ~]$ module avail -------------------------------------------------------- /usr/share/Modules/modulefiles ------------------------------------------...2048 days ago
1565 days ago