Perl script to find palindromic pattern !
#!/usr/bin/perl use strict; use warnings; use strict; my %invert; @invert{ qw[ A C G T ] } = qw[ T G C A ]; my $in = do{ local $/; }; chomp $in; print $in; for my...2100 days ago
Perl script to extract sequence by Ids from multifasta file !
#!/usr/bin/perl -w use strict; my $idsfile = "$ARGV[0]"; my $seqfile = "$ARGV[1]"; my %ids = (); open FILE, $idsfile; while() { chomp; $ids{$_} += 1; }...2097 days ago
2076 days ago
Perl script to extract a sequence from multifasta with range !
# filterfastarange.pl #!/usr/bin/perl use strict; use warnings; #perl filterfastarange.pl 301 600 contigs.fasta > contigs-gt300-lte600.fasta my $minlen = shift or die "Error: `minlen` paramet...2067 days ago
Perl script to break the contigs by 'N'
#!/usr/bin/perl -w use Bio::SeqIO; use strict; my $fasta = Bio::SeqIO->new( -file => "$ARGV[0].parts.fasta",-format=>'fasta'); open(SCAFF,">$ARGV[0].parts.scaff");...2064 days ago
Perl script to split fasta sequence / overlaps
#!/usr/bin/perl use strict; use warnings; my $len = 5000; my $over = 200; my $seq_id=$ARGV[0]; my $seqFile = $ARGV[1]; my $seq; open(my $fh, "2044 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the starting DNA:\n\n"; print "$DNA\n\n"; $revcom = reverse $DNA; $revcom =~ s/...2045 days ago
Perl script to create a consensus of nucleotide sequences !
...H{$b}->[$B]||0) ($H{$a}->[$B]||0) || $prefOrder{$b} $prefOrder{$a} } qw/A T G C/ ]->[0]; } return @cons; } #reference https://www.perlmonks.org/bare/?node_id=5009622033 days ago
Installing pb-assembly on Linux !
...libxml2/2.9.3-foss-2016a BioPerl/1.6.924-foss-2016a-Perl-5.22.1...Perl/5.16.3-goolf-1.4.10 GDAL/2.1...-hdf63c60_3 conda-forge perl: 5.26.2-h470a237_0 conda...py27_1 bioconda perl 5.26.2...2036 days ago
1553 days ago