BBTools for bioinformatician !
...------Reformat.sh Count k-mers/find unknown primers Code: $ reform...100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should b...ge is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be shor...2285 days ago
Illumina based assembly pipeline steps !
...lling Read alignment (Bowtie 2) Sort and index alignments (SAMtools) Primer sequence removal (iVar; ampli...Intersect variants across callers (BCFTools) De novo assembly Primer trimming (Cutadapt; amplicon...891 days ago
Bioinformatics algorithms tutorials
...cBio ReadsSoftware and Hardware Concepts for BioinformaticsFinding us in Homolog.us (Search Algorithms)NGS Genome and RNAseq Assembly - a Hands on PrimerIntroduction to PERL, Python,...3618 days ago
2931 days ago
Introduction to Bioinformatics
...Protein sequence and structure analysis: A practical guide. Topics of Evolutionary Computation VSNS BioComputing Division Bioinformatics -Primer on biosequence comparisons A...3935 days ago
Genome Assembly Tools and Software - PART2 !!
...t starting DNA fragment, often a EST or partial gene segment, as “primer”, to recursively blast...in all sequences that overlaps, directly or indirectly, with the “primer” therefore help to &ldq...2700 days ago
Useful Links for Bioinformaticians
....iacr.bbsrc.ac.uk BioBook Glossary Highveld.com - Internet Directory of Biology and Biotechnology ESG Biology Hypertextbook Home Page DOE Primer on Molecular Genetics Basi...3145 days ago
Best book Titles for Learning Bionformatics
...resa Attwood, David Parry-Smith, 2001, Prentice Hall Bioinformatics: A Primer, Charles Staben, 2001, Jones...Biology, Lawrence Hunter (Editor), 1993, AAAI Press Sequence Analysis Primer, Michael Gribskov and John De...3932 days ago
Interactive Market Intelligence
...cted to be at 9.8% in 2015; 22% of respondents are highly likely to switch primary suppliers of qPCR products; 50% of respondents use pre-designed primer/probe sets.3408 days ago
1483 days ago
3211 days ago
3904 days ago
Comment on "Most Commonly used Awk by Bioinformatician"
Awk, Linux, R tutorial by EMBL http://www.embl.de/~rausch/primer.pdf3843 days ago
Comment on "Five unique traits of effective computational biologist"
...AJ (2009) A Quick Guide for Developing Effective Bioinformatics Programming Skills. PLoS Comput Biol5(12): e1000589. [link] Bassi S (2007) A Primer on Python for Life Science Re...3844 days ago