Results for "Primer"

Blogs

  • BBTools for bioinformatician !

    ...------Reformat.sh Count k-mers/find unknown primers   Code: $ reform...100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should b...ge is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be shor...

    2282 days ago

  • Illumina based assembly pipeline steps !

    ...lling Read alignment (Bowtie 2) Sort and index alignments (SAMtools) Primer sequence removal (iVar; ampli...Intersect variants across callers (BCFTools) De novo assembly Primer trimming (Cutadapt; amplicon...

    889 days ago

Bookmarks

  • Bioinformatics algorithms tutorials

    ...cBio ReadsSoftware and Hardware Concepts for BioinformaticsFinding us in Homolog.us (Search Algorithms)NGS Genome and RNAseq Assembly - a Hands on PrimerIntroduction to PERL, Python,...

    3615 days ago

  • segemehl

    ...tect not only mismatches but also insertions and deletions. Furthermore, segemehl is not limited to a specific read length and is able to map primer- or polyadenylation contamina...

    2929 days ago

  • +6 more Bookmarks

Pages

Top-level pages

Wire posts

  • #Primer3Plus (http://primer3plus.com/) can be used to design the primer sequences #Primer

    1447 days ago

News

  • Interactive Market Intelligence

    ...cted to be at 9.8% in 2015; 22% of respondents are highly likely to switch primary suppliers of qPCR products; 50% of respondents use pre-designed primer/probe sets.

    3406 days ago

  • Primer BLAST !

    BLAST team added a new feature (Max 3' match), shown in Figure 1, to Primer-BLAST that limits the length of 3' exon matches when designing exon-exon spanning primers. This makes it less likely t...

    1480 days ago

ResearchLabs posts

  • BioRG

    ...mes, Metagenomics, Genomic databases, Pattern Discovery in sequences and structures, micro-array data analysis, prediction of regulatory elements, primer design, probe design, phyloge...

    3208 days ago

Video

  • Primer Design for PCR

    In this lecture, I explain how to design working primers for use in PCR. If you are unfamiliar with PCR, watch the following video: http://www.youtube.com/watch?v=2KoLnIwoZKU. Created by:Tyler Maxfield

    3902 days ago

Tags

  • Primer BLAST !

    BLAST team added a new feature (Max 3' match), shown in Figure 1, to Primer-BLAST that limits the length of 3' exon matches when designing exon-exon spanning primers. This makes it less likely that primers specifically designed to amplify transcripts will also amplify genomic DNA contamination in...

    Tags: Primer, BLAST, Feature, Alignments !

    1480 days ago

Comments