Results for "Primer"
Blogs
BBTools for bioinformatician !
...------Reformat.sh Count k-mers/find unknown primers Code: $ reform...100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should b...ge is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be shor...2268 days ago
Illumina based assembly pipeline steps !
...lling Read alignment (Bowtie 2) Sort and index alignments (SAMtools) Primer sequence removal (iVar; ampli...Intersect variants across callers (BCFTools) De novo assembly Primer trimming (Cutadapt; amplicon...874 days ago
Bookmarks
Bioinformatics algorithms tutorials
...cBio ReadsSoftware and Hardware Concepts for BioinformaticsFinding us in Homolog.us (Search Algorithms)NGS Genome and RNAseq Assembly - a Hands on PrimerIntroduction to PERL, Python,...3601 days ago
- ...tect not only mismatches but also insertions and deletions. Furthermore, segemehl is not limited to a specific read length and is able to map primer- or polyadenylation contamina...
2914 days ago
- +6 more Bookmarks
Pages
Introduction to Bioinformatics
...Protein sequence and structure analysis: A practical guide. Topics of Evolutionary Computation VSNS BioComputing Division Bioinformatics -Primer on biosequence comparisons A...3918 days ago
Genome Assembly Tools and Software - PART2 !!
...t starting DNA fragment, often a EST or partial gene segment, as “primer”, to recursively blast...in all sequences that overlaps, directly or indirectly, with the “primer” therefore help to &ldq...2683 days ago
Top-level pages
Useful Links for Bioinformaticians
....iacr.bbsrc.ac.uk BioBook Glossary Highveld.com - Internet Directory of Biology and Biotechnology ESG Biology Hypertextbook Home Page DOE Primer on Molecular Genetics Basi...3128 days ago
Best book Titles for Learning Bionformatics
...resa Attwood, David Parry-Smith, 2001, Prentice Hall Bioinformatics: A Primer, Charles Staben, 2001, Jones...Biology, Lawrence Hunter (Editor), 1993, AAAI Press Sequence Analysis Primer, Michael Gribskov and John De...3915 days ago
- +1 more Top-level pages
Wire posts
News
Interactive Market Intelligence
...cted to be at 9.8% in 2015; 22% of respondents are highly likely to switch primary suppliers of qPCR products; 50% of respondents use pre-designed primer/probe sets.3391 days ago
- BLAST team added a new feature (Max 3' match), shown in Figure 1, to Primer-BLAST that limits the length of 3' exon matches when designing exon-exon spanning primers. This makes it less likely t...
1466 days ago
ResearchLabs posts
- ...mes, Metagenomics, Genomic databases, Pattern Discovery in sequences and structures, micro-array data analysis, prediction of regulatory elements, primer design, probe design, phyloge...
3194 days ago
Video
- In this lecture, I explain how to design working primers for use in PCR. If you are unfamiliar with PCR, watch the following video: http://www.youtube.com/watch?v=2KoLnIwoZKU. Created by:Tyler Maxfield
3887 days ago
Tags
- SAMtools: Primer / Tutorial by Ethan Cerami, Ph.D.keywords: samtools, next-gen, next-generation, sequencing, bowtie, sam, bam, primer, tutorial, how-to, introductionRevisions 1.0: May 30, 2013: First public release on biobits.org. 1.1: July 24, 2013: Updated wi...
Tags: Bioinformatics, NGS, Sequence, Samtools, Primer, Tutorial
2870 days ago
- BLAST team added a new feature (Max 3' match), shown in Figure 1, to Primer-BLAST that limits the length of 3' exon matches when designing exon-exon spanning primers. This makes it less likely that primers specifically designed to amplify transcripts will also amplify genomic DNA contamination in...
Tags: Primer, BLAST, Feature, Alignments !
1466 days ago
- +1 more Tags
Comments
Comment on "Most Commonly used Awk by Bioinformatician"
Awk, Linux, R tutorial by EMBL http://www.embl.de/~rausch/primer.pdf3826 days ago
Comment on "Five unique traits of effective computational biologist"
...AJ (2009) A Quick Guide for Developing Effective Bioinformatics Programming Skills. PLoS Comput Biol5(12): e1000589. [link] Bassi S (2007) A Primer on Python for Life Science Re...3827 days ago
- +1 more Comments
