2895 days ago
Perl subroutine to read and write files
...urn wantarray ? @file : join '', @file; } if($bit eq 'write'){ open InOut,"> $file" or die "Cannot open $file for output: $!\n"; print InOut ref $data eq 'ARRAY' ?...2889 days ago
Perl script introduces control structures, arrays and hashes.
...rray = ('DNA', 'ATGCGTGC', 5, 'RNA', 'AUGC'); print $first_array[0], "\n\n"; #..._size_of_array = @first_array; # implicit way print "Scalar of array: $size_of_ar...'Number of seqs' => 2 ); print $sequence{'DNA'}, "\n"; # Co...2886 days ago
Install ATOM editor on Elemantory OS / Ubuntu
...tions: --color Enable colored output [boolean] [default: true] -v, --version Print the apm version -h, --help Print this usage message Prefi...1200 days ago
Perl script to insert sequence in contig !!
...@_; substr( $CONTIG , $LOC , -length($CONTIG) ) = $SEQ ; return $CONTIG; } $s = "ATATGATGATAGATGATAGTAGATAGATAGATAGATAGATAG"; print "s = $s \n"; print 'insert = '.($s = insertS...2732 days ago
2717 days ago
2717 days ago
Calculate ATGC percentage in parallel with perl
...{ my ($pid, $exit_code, $ident) = @_; #print "** $ident just got out of th..._start( sub { my ($pid,$ident)=@_; #print "** $ident started, pid: $pid...A=~s/AT/AT/g); my $GCper=($GC/($Total)*100); print"$name\t$Total\t$AT\t$GC\t$GCp...2680 days ago
Calculate some statistics for a DNA alignment with Perl
...-method => 'Jukes-Cantor'); print $jcmatrix->print_matrix; ## and for measure...for (sort keys %{$results->[0]} ){ next if /Seq/; printf("%-9s %.4f \n",$_ , $results...2673 days ago
Extracting FASTA sequences based on position with perl script !!
...chomp; next unless /(.+)/; my ($header) = "$/$1_$start-$end\n"; my $seq = ${^POSTMATCH}; $seq =~ s/\s//g; print $header; print +( substr $seq, $start - 1, $...2645 days ago