Blast result parser with Perl and Bioperl
...n, E value, bit score, query frame, query start, query end, hi...import into a spreadsheet program for browsing and further ana...ription\tE value\tbit score\tframe\tquery_start\t"; print OUT...# get the frame of the query sequence...2908 days ago
Find and replace ambiguous characters in fasta file with Perl and Bioperl
...Name1 ...]\n". " -h: help\n". " -m: missing character\n". "Print out the name of sequences with characters other than ATGC-.\n"....ed character. e.g. -m '?' will place ? to the ambigous characters.\n" . "If multiple...2908 days ago
Perl program to implement sliding window !
#!/usr/bin/perl -w my $filename = 'data.txt'; open(my TR, '2908 days ago
Perl to print indivisual nucleotide from a sequence!
#!/usr/bin/perl use strict; use warnings; my $string = "ATGCTTGCGT?AAATG??CT?GCGTA"; my @chars = split("", $string); print "First character: $chars[0]\n";2908 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2903 days ago
Generating a random string with Perl
#!/usr/bin/perl # This function generates random strings of a given length sub generate_random_string { my $length_of_...gth of # the random string to generate my @chars=('a'..'z','A'...number between 0 and scalar @chars $random_string.=$chars[rand @char...2901 days ago
Needleman-Wunsch Algorithm in Perl
#!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needlema...2899 days ago
Count GC Content in nucleotide sequence with Perl
...---------------------------------------------------- #Deal with passed parameters #---------------------...e") ) { print "Couldn't create $out_file\n"; exit; } print "Parameters:\nfasta file = $fasta_f...2899 days ago
Implementation of biological random mutation with Perl
...gs; #sequence for a better recognition my $DNA="AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA \ n"; my $I; my $mutant; srand (time | $$). $mutant=mut...2895 days ago
Perl script to generate a random psuedo DNA sequence !
#!/usr/bin/perl print "Enter a number of nucleotides: \n"; chomp ($N = ); @b=qw/A T G C/;print ">Genome\n";while($l2877 days ago