Results for "Wordpress Tutorial | How To Make A Website Properly With WordPress | Step-By-Step Video Training"
Bio-Scripts
Install Parrot Virtual Machine !
#Parrot is a virtual machine designed to efficientl...is to poke and prod your system to figure out how to bu...ompiler and linker to use........done. inter::make - Is make...L bindings......................skipped. gen::makefile...1549 days ago
Long reads mapper bash script !
#!/bin/bash #only for LONG READS mapping #USAGE: runMapper.sh minim...bash scrip to map your long reads and make it v...me == "bwa" ]; then echo "Mapping with $toolNa...== "lamsa" ]; then echo "Mapping with..."graphmap" ]; then echo "Mapping with $to...2134 days ago
Installing Porechop on Ubuntu !
➜ Tools git:(master) ✗ git clone http...leaning previous compilation: make clean rm -f porechop/src/ada...gnment.o Compiling Porechop: make -j 8 g++ -std=c++14 -Iporech...the ends and splitting reads with inte...(incompatible with --outpu...: -h, --help Show this...2118 days ago
Install Python locally on shared Linux server !
#Install python to local directory #Firstly, I create a folder in my home..../configure --prefix=$HOME/python make && make inst...again for the environment to update properly. At...ommand: which python #it should show y...available: which pip #It should show a pa...2110 days ago
- jitendra@jitendra-UNLOCK-INSTALL[SNP] wget https://github.com/br...--spark-runner controls how spark tools are run vali...ut the generated command line without running it --java-opti...ETA Tool) Annotates intervals with GC content CallCopyRatio...GVCF files into a single GVCF with appropr...
2087 days ago
Perl script to reverse complement a DNA sequence !
#!/usr/bin/perl -w $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; print "Here is the sta...lgorithm, and the reverse complement was wrong!\n"; print "Try again ... \n\n"; # Make a n...2055 days ago
Installing pb-assembly on Linux !
...libtool/2.4.6-foss-2016a Automake/1.1...libtool/2.4.6-foss-2016b Automake/1.14-GCC-4.8.2...makedepend/1.0.5-foss-2016a bzip2...y that PacBio strives for, we make no w...stomer Service for assistance with any #...y that PacBio strives for, we make no...2046 days ago
- (denovo_asm) [jnarayan@hmem00 ~]$ git clone https://github.com/cdunn2001...ers/j/n/jnarayan/FALCON-examples/.git/git-sym-local/cache' make -j -f /home/users/j/n/jnarayan/FALCON-examples/git-sym.makefile...
2046 days ago
- #http://www.nupack.org/downloads/source ➜ tools git:(master) ✗...➜ nupack3.0.6 git:(master) ✗ make make -C...rn value of ‘fgets’, declared with attribute warn_unused_result...rn value of ‘fgets’, declared with attribute warn_unused_result....c sumexp_pk.c: In function ‘makeNewQgIx’: sumexp_pk.c:791:6:...
2038 days ago
- ➜ Tools git:(master) ✗ wget https://github.com/samtools/htslib/releases...ib-1.9/ htslib-1.9/INSTALL htslib-1.9/LICENSE htslib-1.9/Makef...hfile_s3.c m4 tabix.c bgzip.c hts.c Makefile...
2031 days ago
