Results for "installed"
Bio-Scripts
Installing Covid19 Environment !
...############################################ | 100% Preparing transaction: done Verifying transaction: done Executing transaction: \ Krona installed. You still need to manually...938 days ago
Install Php on Ubuntu / Apache server !
#Installing PHP 7.2 with Apache #If you are using Apache as your web server to install PHP and Apache PHP module run the following command: sudo apt install php libapache2-mod-php #Once the packages are installed restart the Apache service: sudo systemctl restart apache2934 days ago
Installing manadatory software for websites hosting !
#See all the installed apt list --installed apt list #Installing Apache #To install Apache, install the latest meta-package apache2 by running: sudo apt update sudo apt install...931 days ago
Installing manadatory software for websites hosting !
#See all the installed apt list --installed apt list #Installing Apache #To install Apache, install the latest meta-package apache2 by running: sudo apt update sudo apt install...931 days ago
- ...---------------------------------------- Total: 5.7 MB The following NEW packages will be INSTALLED: gdbm cond...
840 days ago
- ...---------------------------------------- Total: 16.8 MB The following NEW packages will be INSTALLED: _libgcc_mutex pkgs...
840 days ago
bash script to extract sequence by ids !
...ovel_T016697 Solyc03g033550.3.1 CTGACGTATACAATTAAGCCGCG >BGI_novel_T018109 Solyc03g080075.1.1 GCAAGGGAAAGAAGTATTACTAG Note that seqtk can be installed, for example, using conda.838 days ago
Install Varscan on Ubuntu / Linux !
...se Varscan we simply need to download the distributed jar file into our ~/workspace/bin. As with the other java programs which have already been installed in this section we can invoke...838 days ago
- ...lowing package was automatically installed and is no longer required:...wing additional packages will be installed: libgsl23 libgslcblas0 Su...ibgslcblas0 0 upgraded, 3 newly installed, 0 to remove and 1 not upgrad...files and directories currently installed.) Preparing to unpack .../li...
679 days ago
- (base) [lege@hn1 testVisanu]$ conda create -n pythonENV python=3.10 scipy=1.13.0 astroid babel Channels: - conda-forge - bioconda - defaults Platform: linux-64 Collecting package metadata (repodata.json): done Solving environment: done ==> WARNING: A newer version of conda exists.
7 days ago
