BOL

Latest activity

• • Athar MUtahari@athar243

  

  Athar MUtahari has a new avatar 4500 days ago

  
• • Athar MUtahari@athar243

  

  Athar MUtahari is now a friend with Jitendra Narayan 4500 days ago

  • Athar MUtahari@athar243

  

  • Jitendra Narayan@admin

  
• • Jitendra Narayan@admin

  

  Jitendra Narayan is now a friend with Athar MUtahari 4500 days ago

  • Jitendra Narayan@admin

  

  • Athar MUtahari@athar243

  
• • Rahul Nayak@rahul

  

  Rahul Nayak answered the question Please recommend some books / study material on DNA diagnostics using bioinformatics. 4501 days ago

  Hi Andaleeb, DNA diagnostics using bioinformatics looks very impressive, which recently gained their importance due to industrial growth in human therapeutics and diagnostics sector. Now a dayz, human therapeutics and diagnostics become the larges...
• • RAJESH DETROJA@rajeshdetroja

  

  RAJESH DETROJA answered the question Please recommend some books / study material on DNA diagnostics using bioinformatics. 4501 days ago

  http://lib.freescienceengineering.org/search.php?search_type=magic&search_text=DNA+diagnostics+&submit=Dig+for
• • Andaleeb@andaleeb

  

  Andaleeb asked Please recommend some books / study material on DNA diagnostics using bioinformatics. 4501 days ago
• • Rahul Nayak@rahul

  

  Rahul Nayak answered the question Extract the numeric values from the multiple FASTA sequence file. 4502 days ago

  Hi Alok, You can try this Perl onliner perl -nle '$_ =~s/[^\d.]//g; print "$_\n";' infile Thanks
• • Alok Prajapati@Alok

  

  Alok Prajapati posted a new ad in the Opportunity RA at IISR Kozhikode 4505 days ago
• • Rahul Nayak@rahul

  

  Rahul Nayak posted to the wire 4505 days ago

  A Quick Guide to Organizing Computational Biology Projects http://www.ploscompbiol.org/article/info%3Adoi/10.1371/journal.pcbi.1000424 #ComBio #Projects
• • Jitendra Narayan@admin

  

  Jitendra Narayan commented on a bookmark List of Bioinformatics Vacancy, Jobs, Opportunity websites 4505 days ago

  Bioinformatics positions http://www.joblife.co.za/?s=bioinformatics&location=
• • phu@lethanh

  

  phu published a news post UK executive accused in GlaxoSmithKline China probe 4506 days ago

  GlaxoSmithKline China probe
• • Radha Agarkar@radhaagarkar

  

  Radha Agarkar posted to the wire 4508 days ago

  A unique bioinformatics server http://www.biorxiv.org/collection/bioinformatics
• • Radha Agarkar@radhaagarkar

  

  Radha Agarkar commented on a bookmark R and Bioconductor Tutorial in the group R and Bioconductor 4508 days ago

  R and Bioconductor for NGS data analysis http://master.bioconductor.org/help/course-materials/2012/CSC2012/Bioconductor-tutorial.pdf http://manuals.bioinformatics.ucr.edu/home/ht-seq
• • Radha Agarkar@radhaagarkar

  

  Radha Agarkar commented on a bookmark Next Generation Sequencing (NGS) Tutorials in the group Next Generation Sequencing (NGS) 4508 days ago

  NGS tutorial at http://www.bioinformatics.auckland.ac.nz/workshops/NGS-workshop-update.pdf
• • Neel@neelam

  

  Neel posted to the wire 4508 days ago

  zcat input_file.fastq.gz | awk 'NR%4==1{printf ">%s\n", substr($0,2)}NR%4==2{print}' > output_file.fa #fastaQ2fasta #fastaq #fasta #Oneliner
• • Radha Agarkar@radhaagarkar

  

  Radha Agarkar has a new avatar 4508 days ago

  
• • Alok Prajapati@Alok

  

  Alok Prajapati posted a new ad in the Opportunity Bioinformatics JRF/SRF position at NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY 4508 days ago
• • Jitendra Narayan@admin

  

  Jitendra Narayan answered the question Extract the numeric values from the multiple FASTA sequence file. 4508 days ago

  Hi Alok, You can try following Perl script on ur dataset. It will extract the numeric values and seperate it's chromosome, start and end coordinates with tabs in outFile. usage : perl extractNumber.pl infileName > outFile use strict;use...
• • Alok Prajapati@Alok

  

  Alok Prajapati asked Extract the numeric values from the multiple FASTA sequence file. 4509 days ago

  I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one...

• « Previous
• 395
• 396
• 397
• 398
• 399
• 400
• 401
• 402
• 403
• 404
• 405
• Next »