BOL

I am currently working on NGS, and looking for a nice OS to handle huge amount of genomics data with an ease. Someone suggested me that Window OS will be a bad idea to use for NGS analysis. I need your valuable suggestion for the best.

Thanks

I have a multiple fasta sequence file (~12GB size) with certain coordinate information:

> chr13-/454-4567654 (2347645)
AGTGACTGACTGAAGTGACTGA

> chr14-/524-8367954 (6535786)
AGTGACTGAAGTGACTGA

The fasta sequence string would always have only one or more continuous stretch of numbers, like 13-/454-4567654 (2347645) in this case. Rest all will be either alphabets or other special characters. How can I extract the number and store it back in some array?

I have 198,991 bp long sequence. I ran it through Maker, Glimmer and GeneMarkS. All three gave me different number of predicted genes.Here I am talking about genes that I got through GeneMarkS.

Now when I am using BlastX to find the similar genes, I sometimes get highly dissimilar results. What does that indicate?

For eg:- for the given gene

>gene_id_13
ATGTTCGCGGGCGTAGTGCGCAGTTTCGTGCAGTGGAGACGAGTCGATGACACCGCCGTC
AGAGACGGTGAATGGCAAGACGAACGCGGCCGGATTGACTGGTTCGAATGA

After running blastX for gene 13, I get results with evalue 4.3 and above and sequences that are only 43% similar.

>gene_id_14
ATGCTCGGACTGATGAAGGCCTGCAAAAAGCTCGGCCTGTCGTTCTGGCAGTATCTCTGT
GATCGCATCGGTGTCGATGGCCAGGCCATTCCGCCGCTGGCCGCCCTTGTCGGGGCAAAA
GCCTAA

with this gene, i got the following result

Now if I combine genes 13 and 14. I got

what does that suggest? 

Also, how to find the correct number of predicted genes when all three tools give different results?

Thanks

Can someone please explain how computer identify rings and chains (and complete structure) from a Coordinate file(PDB or Mol2)? As various softwares are available to visualize the structure but i want to know how these software do it, how they identify where a chain start and how ring(or cyclic) structure(like benzene etc) is identified?

I am just interested to know whether you are aware about web servers developed at our group or not. http://www.imtech.res.in/raghava/ 

There are contradictory statement about job scope of bioinformatics. One side we got statement that BI have lot of job prospetives other side lot of student complains that they are not getting jobs. I am interested to know form real bioinformatics persons, did you get job of your choics, if not what major difficulties you are facing. According to you what is trend in bioinformatics from job point of view. What you will advise to youngsters? they should go for bioinformatics or not.

I want to know the common job requirement for bioinformatics post in current scenario ...

Hello everyone, Can you please tell me an online software/tools to detect/predict/find the promoter region in rice plant. Many thanks for your time.

Hi, this is Nikita Bora, I want to know how to perform BLAST between a microrganism proteome and human proteome.. i have tried the stand alone BLAST, but it is not working. can you please suggest me something simple??