BOL

I used the following command to print the blast hit.

[Terminal] blastn -query aaa.fa -db blastdb/nt -evalue 10e-5 -num_threads 4 -max_target_seqs 1 -outfmt '6 qseqid staxid qstart qend sallseqi sstart send evalue length frames qcovs' -out testBlastSee

But the outfile print many hits, I only want the top one.

[Terminal] more testBlastSee                                                                                                                  []
Lactococcus_lactis    1    63350    1    63350    0.0    63350    1/1    100
Lactococcus_lactis    52453    55105    138601    141250    0.0    2654    1/1    100
Lactococcus_lactis    52393    53898    629230    627727    0.0    1508    1/1    100
Lactococcus_lactis    52411    53898    2217595    2216111    0.0    1489    1/1    100
Lactococcus_lactis    52413    53898    2157259    2155777    0.0    1487    1/1    100
Lactococcus_lactis    52452    53898    838503    837059    0.0    1449    1/1    100
Lactococcus_lactis    52453    53860    374322    375726    0.0    1409    1/1    100
Lactococcus_lactis    53859    55105    2154570    2155816    0.0    1247    1/1    100
Lactococcus_lactis    53860    55105    626521    627766    0.0    1246    1/1    100
Lactococcus_lactis    53858    55105    835851    837098    0.0    1248    1/1    100
Lactococcus_lactis    53860    55105    2214905    2216150    0.0    1246    1/1    100
Lactococcus_lactis    53860    55104    374321    373077    0.0    1245    1/1    100
Lactococcus_lactis    53860    55104    138600    137356    0.0    1245    1/1    100
Lactococcus_lactis    53860    55104    839748    838504    0.0    1245    1/1    100
Lactococcus_lactis    40213    41128    508317    507400    0.0    922    1/1    100
Lactococcus_lactis    28448    28695    543445    543703    9e-96    260    1/1    100
Lactococcus_lactis    42193    42376    506963    506780    4e-64    184    1/1    100
Lactococcus_lactis    61964    62163    61646    61845    6e-53    200    1/1    100
Lactococcus_lactis    61646    61845    61964    62163    6e-53    200    1/1    100
Lactococcus_lactis    37541    37672    512963    512832    3e-50    132    1/1    100
Lactococcus_lactis    28816    28933    2360018    2359903    7e-32    118    1/1    100
Lactococcus_lactis    35284    35410    1439702    1439828    1e-30    129    1/1    100
Lactococcus_lactis    28272    28363    1412439    1412348    1e-29    92    1/1    100
Lactococcus_lactis    28193    28270    2360127    2360050    2e-28    78    1/1    100
Lactococcus_lactis    28695    28813    542396    542514    6e-23    122    1/1    100
Lactococcus_lactis    28695    28813    1981268    1981150    6e-23    122    1/1    100
Lactococcus_lactis    28695    28813    2341071    2340953    6e-23    122    1/1    100
Lactococcus_lactis    28695    28812    2360250    2360133    2e-22    121    1/1    100
Lactococcus_lactis    28695    28796    2218330    2218229    8e-22    103    1/1    100
Lactococcus_lactis    28695    28796    2260841    2260740    8e-22    103    1/1    100
Lactococcus_lactis    55066    55147    2154609    2154528    2e-17    82    1/1    100
Lactococcus_lactis    55066    55148    626559    626478    5e-14    83    1/1    100
Lactococcus_lactis    52392    52456    373013    373076    2e-12    65    1/1    100
Lactococcus_lactis    55105    55148    375723    375766    1e-09    44    1/1    100
Lactococcus_lactis    52393    52457    839809    839745    1e-09    66    1/1    100

When I tried Perl on my cluster/server it gives following error !! How to resolve it?

$ perl
perl: warning: Setting locale failed.
perl: warning: Please check that your locale settings:
LANGUAGE = (unset),
LC_ALL = (unset),
LC_PAPER = "de_BE.UTF-8",
LC_ADDRESS = "de_BE.UTF-8",
LC_MONETARY = "de_BE.UTF-8",
LC_NUMERIC = "de_BE.UTF-8",
LC_TELEPHONE = "de_BE.UTF-8",
LC_IDENTIFICATION = "de_BE.UTF-8",
LC_MEASUREMENT = "de_BE.UTF-8",
LC_TIME = "de_BE.UTF-8",
LC_NAME = "de_BE.UTF-8",
LANG = "en_US.UTF-8"
are supported and installed on your system.
perl: warning: Falling back to a fallback locale ("en_US.UTF-8").

I am problem installing Perl module on cluster/server without root. Can you please recommend me a easy way or alternative way to install it.

I am looking for new, interactive and user friendly tools to see chromosomal rearrangements. I tried IGV, but it does not seems to be very helpful for chromosomal rearrangements visualization. Circos look pretty useless, as it does not allow me to explore well. Help Please...

Extract "Seq2" from the list below

>Seq1
GTGCACTAAGAAAAATAAAATTTGTTCTTTTAAGATAATCATTTC
CTGGACGAATATCAATAGCAATAGAATAAGTCCAATCAAATGAT
TGCCGTGATGAACGAACTTGTAATTGTTGATAACTAGAACCAT
GCTGTAAACAAAATTTTGATGACCATTGTGGTCGACCTTCTTGT
TGACGATGTAAACCATTTCCAACTCGCATAACACATGTATTATTA
CGCTGAGCATTATCGAAAGAAAGAAGAAGT
>Seq2
CAGGGCCAGCGCCGCCGACAGGCCGGTGAAGCCGCCGCCGA
CGATGGCCACGTCCACCTGCGCCGGCAGGTCTTGCGACCGCG
GCACGAAGGCGGGGGCGGAATCGGTCCAGTACGGGTCGAGCT
TCATGGCGGCGGCGAGGGGCGGGAAGGGCAGCGTTCGATCAG
GGGCCGGGGTTCAGAGACCCACCACGCCGGGCAGGCCGCCGA
TGTCCTGGATCTCGACATAGCGATAGGCCGGGTTGCCCGGGC

I want to publish my research work on miRNA. I used online "freely" available miRNA dataset, with not known publications, and analysed it. Can you please suggest your experience publishing it in a good Impact Factor Journal? Is this possible to published it? 

I got the following error while running MizBee.How to fiw it.

./MizBee                                    []
OpenJDK 64-Bit Server VM warning: You have loaded library /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so which might have disabled stack guard. The VM will try to fix the stack guard now.
It's highly recommended that you fix the library with 'execstack -c ', or link it with '-z noexecstack'.
Exception in thread "Animation Thread" java.lang.UnsatisfiedLinkError: /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so: /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so: wrong ELF class: ELFCLASS32 (Possible cause: architecture word width mismatch)
    at java.lang.ClassLoader$NativeLibrary.load(Native Method)
    at java.lang.ClassLoader.loadLibrary0(ClassLoader.java:1941)
    at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1857)
    at java.lang.Runtime.loadLibrary0(Runtime.java:870)
    at java.lang.System.loadLibrary(System.java:1122)
    at com.sun.gluegen.runtime.NativeLibLoader.loadLibraryInternal(NativeLibLoader.java:102)
    at com.sun.gluegen.runtime.NativeLibLoader.access$000(NativeLibLoader.java:51)
    at com.sun.gluegen.runtime.NativeLibLoader$1.run(NativeLibLoader.java:70)
    at java.security.AccessController.doPrivileged(Native Method)
    at com.sun.gluegen.runtime.NativeLibLoader.loadGlueGenRT(NativeLibLoader.java:68)
    at com.sun.gluegen.runtime.NativeLibrary.ensureNativeLibLoaded(NativeLibrary.java:399)
    at com.sun.gluegen.runtime.NativeLibrary.open(NativeLibrary.java:163)
    at com.sun.gluegen.runtime.NativeLibrary.open(NativeLibrary.java:129)
    at com.sun.opengl.impl.x11.DRIHack.begin(DRIHack.java:109)
    at com.sun.opengl.impl.x11.X11GLDrawableFactory.(X11GLDrawableFactory.java:99)
    at java.lang.Class.forName0(Native Method)
    at java.lang.Class.forName(Class.java:264)
    at javax.media.opengl.GLDrawableFactory.getFactory(GLDrawableFactory.java:111)
    at processing.opengl.PGraphicsOpenGL.allocate(PGraphicsOpenGL.java:173)
    at processing.core.PGraphics3D.setSize(PGraphics3D.java:323)
    at processing.core.PApplet.makeGraphics(PApplet.java:1321)
    at processing.core.PApplet.size(PApplet.java:1142)
    at processing.core.PApplet.size(PApplet.java:1102)
    at MizBee.setup(MizBee.java:87)
    at processing.core.PApplet.handleDraw(PApplet.java:1571)
    at processing.core.PApplet.run(PApplet.java:1496)
    at java.lang.Thread.run(Thread.java:745)

I tried SyMAP but got the following error 

$ ./symap []

Starting SyMAP v4.2 - Project Manager
SyMAP Version v4.2
Java Version 1.8.0_91, mem: 1820M
Build 116
Reading from file symap.config
The built-in MySQL server cannot run because a MySQL server is already running on this computer.
Please stop that server, or else specify a MySQL host name in the symap.config file.

If i have a set of miRNA sequences, what are the tools that are available to predict the target genes? I tried miRanda and mirdb, are there any  tools or databases that do the same, as the rna is not already known i cant use targetscan etc. The tool must predict the target from the fasta sequence of miRNA.

Thank you

I am trying to merge contigs, generated from different assemblies with MeGAMerge, but it failed after running few hour !! Following are the error I got on command prompt. Any suggestions??

perl MeGAMerge-1.1.pl -f MergedDIR allContigs_MIRA_assembled.fa
Running Newbler assembly with 308261 sequences
runAssembly -force -large -rip -mi 98 -ml 80 -pairt -cpu 4 -a 200 -o MergedDIR/newbler MergedDIR/newblerIn.fasta 1>/dev/null 2>/dev/null
Running Minimus2 with 331388 sequences
minimus2 -D CONSERR=0.06 -D MINID=98 -D OVERLAP=80 MergedDIR/minimus.fasta 1>/dev/null 2>/dev/null
minimus2 -D CONSERR=0.06 -D MINID=98 -D OVERLAP=80 MergedDIR/minimus.fasta 1>/dev/null 2>/dev/null failed:
Died at MeGAMerge-1.1.pl line 283.