2307 days ago
Bioinformatics PhDs - Cover Letter
...he courses that (based on the job description) you would be expected to offer, let them know. If you have not had that opportunity, but your fields and research fall within the...3410 days ago
Computer simulation of genetic mechanism !!
...lds. Within the overall task of simulation, there are three primary sub-fields: model design, model executio...xperimental results; and (3) they enable connecting biology with other fields of study ranging from physiol...3019 days ago
Following the scientific literature: A personal practical guide for young computational biologists
... can you follow the most up-to-date science of interest and what papers/journals you should follow. The guide is biased towards the fields of genomics/systems biology.(...3952 days ago
International Conference on Bioinformatics Models, Methods and Algorithms
...ta management and data mining, machine learning, pattern recognition, computational evolutionary biology, computational genomics and other related fields. Position Paper Submission E...3544 days ago
Basic Notions in Molecular Biology and Genetics
...as stablished on 2007, took it a bit of years to make it real this initative, although, nowadays, we're working on some projects involved in those fields. This research group belongs...3746 days ago
3990 days ago
Best book Titles for Learning Bionformatics
...s to Bioinformatics (Introduction to Biotechniques Series), Luke Alphey, 1997, Springer Verlag Automated DNA sequencing and analysis, Adams M.D., Fields C., Venter J.C. (Editors), 19...3962 days ago
3874 days ago
NCBI to assist in Virus Hunting Data Science Hackathon
...bsp;San Diego State University! NCBI Hackathon specifically looking for folks who have experience in computational virus hunting or adjacent fields to identify known, taxonomica...2042 days ago
"Advances in Molecular Dynamics of Biomolecules" December 3-4, 2013 @ JNU
...lgorithms combine domain knowledge from various disciplines of basic science and computer programming, training manpower in such interdisciplinary fields may be hardly achieved within...3921 days ago
National Training on Bioinformatics Computational Tools for Microbial Research Nov 19 to 30, 2013
Agricultural research in modern scientific arena is being represented by proper integration among various research fields of biological, chemical and physical sciences, because this f...3917 days ago
3847 days ago
3744 days ago
Computer Theory & Genetics: George Chao at TEDxUMNSalon
...mputational techniques to learn from genetic data. He would like to go into a career of research into the application of bioinformatics in various fields. ---- The individuals invol...3960 days ago
Showreel 2008 - Cortical Studios
...tics company that combines 3D animation, multimedia and scientific knowledge to meet your communication needs. With our academic background in the fields of biotechnology and molecula...3902 days ago
Fill up the form and blast with perl
...quence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabidopsis.org/Blast/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorithm' => 'bla...2369 days ago
Create genome scaffolding with Perl
...-separated values, got %d)", scalar(@fields)), -verbose =...e) ? 1 : 0; my $longTarget = (1 - $shortTarget); my $sName = $fields[9 + ($shortTarget * 4)];...2352 days ago
Comment on "Sibelia: A comparative genomics tool"
...block id>,Start=<x>,End=<y> Where "<header>" is a header of the FASTA sequence where the block instance is located. Other fields are described in section "Coo...1329 days ago
Comment on "Various scholarships around the world !!"
...promote basic sciences in Korea. Twenty-eight Research Centers have been launched and each Center has been yielding outstanding results in various fields of research.The IBS "You...2164 days ago