Results for "Map Autom Service"
Bio-Scripts
Map them agaist reference avaga genome using following codes git clone https://github.com/lh3/bwa.git cd bwa; make bwa index ref.fa bwa mem -x pacbio ref.fa pacbio.fq > aln.sam bwa mem -x ont2d ref.fa ont-2D.fq > aln.sam1768 days ago
- $ sudo apt install npm Reading package lists... Done Building...e-path-is-absolute node-pseudomap node-qs node-read node-read-p...e-combined-stream node-concat-map node-cookie-jar node-delayed-...nic/universe amd64 node-pseudomap all 1.0.2-1 [3,534 B] Get:21...1) ... Setting up node-pseudomap (1....
1596 days ago
- use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v6
1602 days ago
Bash commandline to install Anaconda !
#The line begins with $ are the commands $ mkdir tmp $ cd tmp/ $ curl -O htt....6.1-py37_1 ... installing: mistune-0.8.4-py37h7b6447c_0 ... installing: mkl-service-1.1.2-py37he904b0f_5 ... ins...1598 days ago
Installing ggplot2 and its dependencies on Ubuntu !
jit@jit-HP-Pro-3335-MT:~/Downloads/MitoHunter/minidot/bin$ sudo R...-fpic -g -O2 -fdebug-prefix-map=/build/r-base-AitvI6/r-base-3...-fpic -g -O2 -fdebug-prefix-map=/build/r-base-AitvI6/r-base-3...pic -fpic -g -O2 -fdebug-prefix-map=/...pic -fpic -g -O2 -fdebug-prefix-map=/bu...1593 days ago
Installing docker for Bioinformatics on Ubuntu !
jit@jit-HP-Pro-3335-MT:~/Downloads$ sudo apt-get remove docker docker-engine d...gins secret Manage Docker secrets service Manage servi...or more containers port List port mappings or a specific mapping for the container ps...1556 days ago
Pack a perl program with their dependencies on Ubuntu !
...tion. GSP4PDB is part of the services provided by the Bio...Jit@jit.aber Sequence Tube Maps: displays multiple genomic sequences in the form of a tube mapBy Jit 5 days ago...ion of genomic sequence graphs. It automatically generates a "tube map"-...1554 days ago
Commands to install conda in Ubuntu !
jit@jit-HP-Pro-3335-MT:~/Downloads$ mkdir jittmp jit@ji...T LIMITED TO, P ROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFI...mistune-0.8.4-py37h7b6447c_0 ... installing: mkl-service-1.1.2-py37he904b0f_5 ... ins...1554 days ago
- (base) jit@jit-HP-Pro-3335-MT:~/Downloads/testDock$ docker build -t autocontampr . Sending build context to Docker daemon 9.024MB Step 1/16 : FROM ubuntu:14.04 ---...
1485 days ago
- (JitMetaENV) ➜ assembly conda install -c bioconda prokka Collecting package metadata (current_repodata.json): done Solving environment: failed with initial frozen so...
1258 days ago
