Fill up the form and blast with perl
use WWW::Mechanize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabi...2375 days ago
Insert the sequence at desire location in multi-fasta file with Perl
#!/usr/bin/perl use warnings; use strict; use Bio::SeqIO; use Bio::Seq; use File::Copy; #ARGV[0] should be in following format --- Keep the coordinate sorte...2364 days ago
Create genome scaffolding with Perl
..." ") || ($b2 eq " ")){ ## equal bases, or absent bases, so consensus is easy return($b1); } # if different, convert to upper case to simplify lookup my $bc = uc(($b1 cmp $b2)...2358 days ago
Remove duplicate lines with perl
#! perl -sw use strict; my %lines; #open DATA, $ARGV[0] or die "Couldn't open $ARGV[0]: $!\n"; while () { print if not $lines{$_}++; } __DATA__ apple apple plum vinegar apple banana banana banana apple2343 days ago
Remove the duplicated line present only next to each other with Perl
#!/usr/bin/perl use strict; use warnings; { $_ = ; my $next_line; while( $next_line = ) { #print "current line: $_ -- next line: $next_line$/...2343 days ago
Perl script to read multi fasta sequence one by one
...utfile $!"; print OUT "$key\n$fastaSeq{$key}\n"; } sub readfasta { (my $file)=@_; my %sequence; my $header; my $temp_seq; #suppose fasta files contains mult...2271 days ago
2260 days ago
Perl script to find coding regions in DNA sequences
...# extract the two values or columns with a regular expression # A group of letters and a decimal numb...a regular expression will be used searching for all of the # possible groups of three symbols (option g)...2205 days ago
2201 days ago
2194 days ago