Results for "NT"
Bio-Scripts
#!/bin/bash cd `pwd` perl ~/apps/SSPACE-1.2_linux-x86_64/SSPACE_v1-2.pl \ -l libraries.txt \ -s Contigs_over200_nocp.fasta \ -k 5 \ -a 0.7 \ -x 1 \ -m 30 \ -o 20 \ -b Rayk31_scaffolds_extension1774 days ago
Perl script to run in parellel !
...$pm->start and next; my $count = 0; foreach my $chr_set...ys %genome) { $count++; if ( ( $count % $...($chr_set, $chr_seq) = @_; print "starting XFOIL instance with...$gene_info->length; my $GCcount = $sequence =~ tr/GC|gc//;...1738 days ago
Find and replace in multifasta or fasta header with perl onliner
You have a fasta file and you want to replace: "|" You are told to replace that by "_" perl -i -p -e "s/\|/_/g" genome.fasta -i = inplace editing -p = loop over lines and print each line (after processing) -e = command line script1667 days ago
- ...@s = split(/\t/); if(scalar(@s) >= 3){$c++;}} print "$c\n";'` echo "num bp: "$NU...v "#" | awk -F "\t" '{if (!match($NF, "0/1")) print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t...; } else { SUM+=length($4)-length($5)}} END { print SUM}'` echo "num snp: "$NUM_...
1656 days ago
Samtools commands for bioinformatician !
## count mapped reads samtools view -...a ### converting sam file into bam # -b : output is bam #...pecified and show them # -f INT show flag matches samtools -..._sej_sorted.bam.bam ### identifying genome variants (mpileu...ligned.vcf ### show alignment # first arg is sorted bam fi...1655 days ago
Perl script to remove duplicated lines !
...$_ = ; my $next_line; while( $next_line = ) { #print "current line: $_ -- next line: $next_...$_ ne $next_line; } continue { $_ = $next_line; } print $_ if eof; } __DATA__ appl...1612 days ago
Bash script to download SRA file !
...ly compatible with any downstream tools, so it's necessary to put things into FASTQ for further processing...rmat when aligning. wget ftp://ftp-trace.ncbi.nlm.nih.gov/sra/sra instant/reads/ByRun/sra/SRR/SRR177/SR...1611 days ago
Bash script to alignment of short reads against reference genome !
....bam ##Breaking it down by line: #alignment with bwa: bwa mem -t $threads...nds the indexes using this) and the input alignment files. The first file should...m --- this marks reads which appear to be redundant PCR duplicates based on their...1611 days ago
- use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v6
1611 days ago
Install Samtools, Bcftools and htslib on Ubuntu !
#Inspired from online search sudo apt-get update sudo apt-get install gcc sudo apt-get install make sudo apt-get install libbz2-dev sudo apt-get install zlib1g-d...1610 days ago
