Results for "B"
Bio-Scripts
Bash script to download SRA file !
...data in a particular compressed format (SRA!) that isn't directly compatible with any downstream tools,...r. We'll use them in this format when aligning. wget ftp://ftp-trace.ncbi.nlm.nih.gov/sra/sra instant/...1612 days ago
Bash script to alignment of short reads against reference genome !
bwa mem -t 40 -R '@RG\tID:K12\t...tq.gz \ | samtools view -b - >SRR1770413.raw.bam sambamba sort SRR1770413.r...n by line: #alignment with bwa: bwa mem -t $threads -R '@R...the base reference file name (bwa finds the indexes using thi...tq.gz \ | samtools view -b - >SRR341549.raw.minimap2.bam...1612 days ago
- use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v6
1612 days ago
Install Samtools, Bcftools and htslib on Ubuntu !
...udo apt-get install make sudo apt-get install libbz2-dev sudo apt-get install z...install libncursesw5-dev sudo apt-get install liblzma-dev cd /usr/bin wget...samtools-1.9.tar.bz2 tar -vxjf samtools-1.9.tar.bz2 cd samtools-1.9 make c...1611 days ago
- sub kmers { my $seq = shift or return; my $len = length $seq; my @kmers; for (my $i = 0; ($i + $KMER_SIZE)
1610 days ago
Bash commandline to install Anaconda !
...019.03-Linux-x86_64.sh 45c851b7497cc14d5ca060064394569f724b67d9b5f98a926ed49b834a6bb73a...> yes Anaconda3 will now be installed into this location...9.1.0-py37_1 ... installing: backcall-0.1.0-py37_0 ... inst...nstalling: wrapt-1.11.1-py37h7b6447c_0 ... installing: wurli...1608 days ago
Bash command to install Miniconda !
(base) [wsu29@bladeamd-2 tmp]$ wget https://r...ved [71785000/71785000] (base) [wsu29@bladeamd-2 tmp]$ s...ocation - Press CTRL-C to abort the installation - Or s...y37_0 - sqlite==3.30.0=h7b6447c_0 - tk==8.6.8=hbc83...orkshop/wsu29/miniconda3/condabin/conda no change /data/...1608 days ago
Bash command to install bwa, samtools, picard !
(base) [wsu29@bladeamd-2 tmp]$ conda install bwa Collecting package metadat...1.1.1b-h7b6447c_1 --> 1.1.1d-h7b6447....67.0 | hbc83047_0 145 KB h...h553295d_15 25 KB gfortran_impl_linux-64-7...1608 days ago
Bash command to install GATK, Bedtools and SnpEff !
(my_GATK) [wsu29@bladeamd-2 tmp]$ conda install...r36h6115d3f_0 3.6 MB r-glue-1.3.1...r36h6115d3f_0 174 KB r-reshape2-1.4.3...ux-64::r-plyr-1.8.4-r36h29659fb_0 r-r6 pkgs/...r-pillar-1.3.1 | 180 KB | ########################...1608 days ago
- ...rget_arch=x86_64&target_distro=Ubuntu&target_version=1804&target_type=deblocal $ wget https://develo....nvidia.com/compute/cuda/repos/ubuntu1804/x86_64/cuda-ubuntu180...ctet-stream] Saving to: ‘cuda-ubuntu1804.pin’ cuda-ubuntu18...10.2.89-440.33.01_1.0-1_amd64.deb Resolving developer.download...
1606 days ago
