Results for "6"
Bio-Scripts
# Convert FASTQ to FASTA seqtk seq -a IN.fastq > OUT.fasta # Convert FASTQ to FASTA and set bases of quality lower than 20 to N seqtk seq -aQ64 -q20 -n N IN.fastq > OUT.fasta # Download Seqtk https://github.com/lh3/seqtk1774 days ago
- #!/bin/bash cd `pwd` perl ~/apps/SSPACE-1.2_linux-x86_64/SSPACE_v1-2.pl \ -l libraries.txt \ -s Contigs_over200_nocp.fasta \ -k 5 \ -a 0.7 \ -x 1 \ -m 30 \ -o 20 \ -b Rayk31_scaffolds_extension
1771 days ago
- ...1 |grep -v "#" | awk -F "\t" '{if (!match($NF, "0/1")) print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t"$8}' | tr ';' ' ' | sed s/AB=//g | awk -v WEIGHT=0 '{if ($6 >= WEIGHT) print $0}' | awk -...
1653 days ago
Samtools commands for bioinformatician !
## count mapped reads samtools view -c -F 260 mapping_file.bam ### converting sam file into fasta samtools fasta reads_mapped.sam > reads.fasta ### converting sam file in...1651 days ago
Bash script to alignment of short reads against reference genome !
...40 -R '@RG\tID:K12\tSM:K12' \ E.coli_K12_MG1655.fa SRR1770413_1.fastq.gz SR...e name K12" #reference and FASTQs E.coli_K12_MG1655.fa SRR1770413_1.fastq.gz SR...RG\tID:O104_H4\tSM:O104_H4' \ E.coli_K12_MG1655.fa SRR341549_1.fastq.gz SR...1608 days ago
- use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v6
1608 days ago
Bash commandline to install Anaconda !
...ive/Anaconda3-2019.03-Linux-x86_64.sh % Total % Receive...installing: python-3.7.3-h0371630_0 ... Python 3.7.3 instal...y37_0 ... installing: curl-7.64.0-hbc83047_2 ... installing...nstalling: multipledispatch-0.6.0-py37_0 ... installing: nlt...1604 days ago
Bash command to install Miniconda !
...nda/Miniconda3-latest-Linux-x86_64.sh --2020-02-01 13:25:25--...o: `Miniconda3-latest-Linux-x86_64.sh' 100%[==============...- ca-certificates==2019.10.16=0 - certifi==2019.9.11=p...4.2=py37_0 - wheel==0.33.6=py37_0 - xz==5.2.4=h14c3...1604 days ago
Bash command to install bwa, samtools, picard !
...stency: - defaults/linux-64::numba==0.43.1=py37h962f231_0 - defaults/linux-64...onda_depends pkgs/main/linux-64::_anaconda_depends-2019.03-p...0.8 | h7b6447c_0 105 KB cur...2 KB binutils_impl_linux-64-2.33.1| he6710b0_7...1604 days ago
Bash command to install GATK, Bedtools and SnpEff !
...163 KB r-digest-0.6.18 | r36h96ca72...me-3.1_139 | r36ha65eedd_0 2.2 MB...gs/r/noarch::r-gdata-2.18.0-r36h6115d3f_0 r-ggplot2...################# | 100% r-r6-2.4.0 | 68 KB |...1604 days ago
