Script to rapid genome clustering based on pairwise ANI
First, create a blast+ database: makeblastdb -in -dbtype nucl -out Next, use megablast from blast+ package to perform all-vs-all blastn of sequences: blastn -quer...678 days ago
Genome Scaffolding and gap filling !
scaffolding with ARCS v1.0.3 (−c3, −l,4, −a,0.9, −z500, −m50, −20 000, −e30000, −s90). https://github.com/bcgsc/arcs Next, automated gap filling was performed using Sealer v2.0.1 (−L150, -P10, −k75-115 [step = 10]) https://github.com/bcgsc/abyss/tree/sealer-release663 days ago
Identify genome-wide synteny with LASTZ alignment
#This is the walkstrough how to identifiy genome-wide synteny markers based on LASTZ alignment. Step1:Mask the repeat sequences for both genom...560 days ago
Perl script to find inverted repeats !
#!/usr/bin/perl use strict; use warnings; use Bio::SeqIO; use Bio::Tools::Run::RepeatMasker; my $genome_file = "genome.fasta"; # read genome sequ...:RepeatMasker->new(); my $rm_report = $rm->run($genom...468 days ago
Download lumpy skin disease data !
Location https://www.ncbi.nlm.nih.gov/sra?linkname=bioproject_sra_all&from_uid=880745 The raw genome sequence data from the 2022 outbreak in India is available in the SRA Project PRJNA880745453 days ago
Python script to convert Multi-line Fasta to Single-line Fasta
def multi_to_single_line_fasta(input_filename, output_file...n') output_file.write(line.strip() + '\n')...e current_sequence += line.strip()...138 days ago
137 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.gff'; my $genom...137 days ago
Raku script to find repeats in sequences !
sub find-repeats($sequence, $min-repeat-length = 3) { my @repeats; for ^($se...return @repeats; } # Example usage my $genome-sequence = "ATCGATCGATCGATCG"; my @result = find-repeats($genom...137 days ago
Raku script to find microsatellites in DNA fragments !
sub find-microsatellites($sequence, $min-repeat-length = 2, $max-repeat-length = 6, $min...@microsatellites.unique; } # Example usage my $genome-sequence = "ATCGATCGATCGATCGATCG"; my @result = find-microsatellites($genom...137 days ago