Perl script to Mutate a DNA Sequence
#!/usr/local/bin/perl -w # This script randomly mutates the DNA sequence and generates 10 successive mutation results. # While executing this script it asks for the file name of t...2931 days ago
Retrieve NCBI GenBank records with a range of accession numbers
...); } message( $param{verbose}, "ESearch results could not be parsed. Resubmit...t) ) { message( $param{verbose}, "EFetch results could not be parsed. Resubmit...2931 days ago
A multilayer perceptron (MLP) neural network in Perl
#!/usr/local/bin/perl -w #################################################### #MLP neural network in Perl Original source code by Phil Brierley #Translated into pe...2931 days ago
Blast result parser with Perl and Bioperl
...top N hits of each blast search result. # For each hit, the following results are reported: # accesion num...start, query end, hit start, hit end, positives, and identical # The results are tab-deliminated and ready...2929 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
...subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[...# matched text = $& if(exists $results{$&}) {...} else { $results{$&} = 1; } } for...2924 days ago
2887 days ago
Calculate some statistics for a DNA alignment with Perl
...y ($seq1id,$seq2id) = map { $_->display_id } $alnobj->each_seq; my $results = $stats->calc_KaKs_pair($alnobj, $seq1id, $seq2id); print "comparing ".$results->[0]{'Seq1'}." and ".$results...2664 days ago
Create genome scaffolding with Perl
#!/usr/bin/perl use warnings; use strict; use English; use Pod::Usage; ## uses pod documentation in usage code use Getopt::Long qw(:config auto_version auto_he...2323 days ago
2279 days ago
2138 days ago