Comment on "Tools for Searching Repeats And Palindromic Sequences"
I wrote a tools "Palindromer" to find palindromes in whole genome sequences. You can try https://github.com/jnarayan81/Palindromer . I am happy to improve it, if any features are requested.2071 days ago
Comment on "Long read assembly workshop !"
Long reads base bacterial genome assembly https://inf-biox121.readthedocs.io/en/2016/Assembly/practicals/07_Assembly_using_minasm+racon.html2097 days ago
Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
...it0hvxthQzWVuMHZXwxTHFR%2FPr47VA7Ra0oPN4ypOkwYhs3y5zH57EjP6RkxSuGH6DrgMYhqIXdOgQ0Fd6782B6IiCSYq&jobid=2188714#keyWordSearch=bioinformatics&locationSearch=2115 days ago
Comment on "List of Bioinformatics and Computational Biology Journals"
You can also bioinformatics tools at https://www.journals.elsevier.com/information-and-software-technology/short-communications/information-and-software-technology-now-publishing-short-com2132 days ago
Comment on "Indexcov: fast coverage quality control for whole-genome sequencing"
...ronment: done ## Package Plan ## environment location: /home/urbe/anaconda3 ad...ld ---------------------------|----------------- ca-certificates-2018.8.24 | ha4d...oconda The following packages will be UPDATED: ca-certificates: 2018.8.13-ha4d7...2134 days ago
Comment on "HALC: High throughput algorithm for long read error correction"
...nding short reads in FASTA format. The initial short reads in FASTA format (only for -ordinary mode; obtained with cat left_reads.fa >short_reads.fa and then cat right_reads.fa >>short...2150 days ago
2157 days ago
Comment on "Nanopolis: polish a genome assembly"
# Index the draft genome bwa index draft.fa # Align the basecalled reads to the draft sequence bwa me...hed.{1}.vcf -w {1} -r reads.fa -b reads.sorted.bam -g draft.fa -t 4 --min-candidate-frequency 0.1 nanopol...2158 days ago
Comment on "Installing Porechop on Ubuntu !"
....0 Barcode 95 (forward) 80.0 80.8 Barcode 96 (forward) 79.2 76.0 Trimming adapters from read ends SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT 1D2_part_2...2164 days ago
Comment on "Interview Puzzles for Bioinformatician !"
...ven or Hell Puzzle 10 Coins Puzzle King and Wine Bottles 3 Mislabeled Jars Red and Blue Marbles Puzzle Gold Bar Puzzle 100 Doors Puzzle You can also refer GeeksforGeeks , i...2177 days ago