1993 days ago
Comment on "nanofilt: Filtering and trimming of long read sequencing data"
Nanofilt steps https://gigabaseorgigabyte.wordpress.com/2017/06/05/trimming-and-filtering-oxford-nanopore-sequencing-reads/2098 days ago
2098 days ago
Comment on "Installing Porechop on Ubuntu !"
...Barcode 96 (forward) 79.2 76.0 Trimming adapters from read ends SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT 1D2_part_2_start: CTTCGTTC...2164 days ago
Comment on "List of Bioinformatics Vacancy, Jobs, Opportunity websites"
Bioinformatics jobs at https://www.monster.com/jobs/search/?q=Bioinformatics&intcid=skr_navigation_nhpso_searchMain&jobid=1985086042165 days ago
Comment on "Various scholarships around the world !!"
...hope that the YS Fellowship serves as a stepping stone for our research fellows to be appointed as independent principal investigators at the prestige instituti...2178 days ago
Comment on "LAMSA: fast split read alignment with long approximate matches"
...Mismatch penalty for SW-alignment. [3] -O --open-pen [INT(,INT,INT,INT)] Gap open penalty for SW-alignmen...xtend: insertion, deletion). [5(,5,5,5)] -E --ext-pen [INT(,INT,INT,INT)] Gap extension penalty for SW-ali...2181 days ago
Comment on "Running Trinity on RNA-seq !"
...ou will likely want to pursue to explore aspects of the biology of your organism based on your assembled t...unctionally annotate the transcripts using Trinotate. If your organism has an assembled genome,...2182 days ago
Comment on "Installing Perl environment on Linux"
...gt; Working on Data::StagFetching http://www.cpan.org/authors/id/C/CM/CMUNGALL/Data-Stag-0.14.tar.gz ... O...ring--> Working on IO::StringFetching http://www.cpan.org/authors/id/G/GA/GAAS/IO-String-1.08.tar.gz .....2184 days ago
2196 days ago