Comment on "Far Manager Commands and Links !"
...me F6- sort by size F7- do not sort F8- sort by creation time F9- sort by access time F10- sort by description F11- sort by file owner F12- start sorting menu...974 days ago
Comment on "Basic docker commands !"
Start the docker container docker start [options] container_id Stop the docker container docker stop --time=20 container_id Kill a docker container docker kill [option] container_id1006 days ago
Comment on "Sibelia: A comparative genomics tool"
...n sections separated by dashes. Each section starts with the synteny block ID. T...sequences are treated as positive strands 3. Start -- one-based index of the fir...ion. This process continues step by step, we start with small values of K to obt...1319 days ago
1554 days ago
Comment on "Various scholarships around the world !!"
The Start-up Research Grant (SRG) scheme aims to assist researchers to initiate their research career in a new institution. It is a two-year grant meant to enable resear...1585 days ago
Comment on "How to set up SSH on Ubuntu 18.04"
...p;openssh-server package by typing: sudo apt updatesudo apt install openssh-server Once the installation is completed, the SSH service will start automatically. To verify that...1590 days ago
Comment on "Installing Porechop on Ubuntu !"
...Looking for known adapter sets10,000 / 10,000 (100.0%) Best read Best start read end Set %ID %ID SQK-NSK...TCAGTTACGTATTGCT SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT 1D2_part_2_start: CTTCGTTCAGTTACGTATTGCTGGCGTC...2140 days ago
Comment on "Run miniasm assembler on nanopore reads !"
...ot have a correction or consensus step, and therefore the resulting assemblies are contiguous (i.e. long) but very noisy (i.e. full of errors) We start with an all against all compa...2209 days ago
Comment on "GraphMap - A highly sensitive and accurate mapper for long, error-prone reads"
.../2). [-1] -v, --verbose INT Verbose level. If equal to 0 nothing except strict output will be placed on stdout. [5] -s, --start INT Ordinal number of the read from which to start processing data. [0] -n, --nu...2326 days ago
Comment on "Does anyone have Nanopore latest updates?"
Nanopore DNA sequencing technology can diagnose infection and detect drug-resistance http://www.laboratorytalk.com/news/usb-stick-could-revolutionise-gene-sequencing/407180.article3451 days ago