Results for "Copy-Number"
Bio-Scripts
# To follow these instructions, we'll assume your system admins have already installed these essentials: # Debian/Ubuntu system admins should run: sudo apt-get install...2151 days ago
Count the frequency of base G in a given DNA sequence
#!/usr/bin/perl use strict; use warnings; my $DNA = "GATTACACAT"; #initialize $countG and $currentPos my $countG = 0; my $currentPos = 0; #calculate the leng...2923 days ago
Perl script to count the number of Adenine, Thymine, Guanine and Cytosine in your DNA Sequence
#!/usr/local/bin/perl -w # While executing this script it asks for the file name of the DNA sequence. If the sequence file is not available in the same directory of th...2922 days ago
Retrieve NCBI GenBank records with a range of accession numbers
#!/usr/bin/perl #FILE: ncbi_search.pl #AUTH: Paul Stothard (paul.stothard@gmail.com) use warnings; use strict; use Getopt::Long; use LWP::Simple; use URI::Esca...2922 days ago
Blast result parser with Perl and Bioperl
#!/usr/local/bin/perl # # Dr. Xiaodong Bai # It may be freely distributed under GNU General Public License. # This script will parse a NCBI blastx output file and o...2921 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2916 days ago
Generating a random string with Perl
#!/usr/bin/perl # This function generates random strings of a given length sub generate_random_string { my $length_of_randomstring=shift;# the length of # th...2914 days ago
Perl script to generate a random psuedo DNA sequence !
#!/usr/bin/perl print "Enter a number of nucleotides: \n"; chomp ($N = ); @b=qw/A T G C/;print ">Genome\n";while($l2890 days ago
Perl script introduces control structures, arrays and hashes.
#!/usr/bin/env perl use strict; use warnings; my @first_array = ('DNA', 'ATGCGTGC', 5, 'RNA', 'AUGC'); print $first_array[0], "\n\n"; # Scalar gives actual siz...2869 days ago
- #! /usr/local/bin/perl5.8.3 -w ### ### Script Name : calcN50.pl ### Description : This script calculates the N50 of a collection of sequences in a fasta file ### In...
2711 days ago
