1553 days ago
Pack a perl program with their dependencies on Ubuntu !
#Follow steps to create your own executable ./web jit@jit-HP-Pro-3335-MT:~/Download...sage table derived from highly‐expressed A. gambiae genes is appended below. Biote...he human genome reveals that about sixty percent of genes are...1511 days ago
Sequence Ids conversion files !
...INARY/ 03/07/2020, 07:49:00 GENE_INFO/ 03/07/2020, 07:48:00...15.1 kB 30/06/2020, 23:01:00 expression/ 06/03/2017, 05:30:00...ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/gene2go.gz ftp://ftp.nc...z ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/gene2refseq.gz ftp://ftp.ncbi...1402 days ago
Bash script to extract intronic fragments !
#To obtain introns, we simply need the gene and exonic coordinates; #by subtracting the exonic regions from the genic...ronic region. gunzip -c genome_file.gtf.gz | awk 'BEGIN{OFS="\t";} $3=="gene" {pri...1366 days ago
Bash script to get intergenic region from genome files !
#For the intergenic region, we will require the size of the chromosomes. wget http://xxx.chrom.sizes cat xxx....xxx.chrom.sizes gunzip -c genome_file.gtf.gz | awk 'BEGIN{OFS="\t";} $3=="gene" {pri...1366 days ago
Install and set up i-adhore for synteny and wgd analysis ! -- step by step --
#Need to download i-adhore-3.0.01.tar.gz from https://wdiceryfd...34") -- Configuring done -- Generating done -- Build files ha...t src/CMakeFiles/i-adhore.dir/Gene.cpp.o [ 63%] Building CXX ob...conda3/envs/wgd/./API/iADHoRe/gene.pm -- Installing: /home/urbe...stset/datasetI/arath_2_3_beta/genes.txt...1204 days ago
bash script to extract sequence by ids !
Use a Perl one-liner, grep and seqtk subseq to extract the desired fasta sequences: # Create test input:...I_novel_T016141 Solyc03g007600.3.1 ACGTACGTACGTACGTACGTACG EOF cat > gene_ids.txt ids_gene_ids.t...823 days ago
299 days ago
94 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF fi...to/your/file.gff'; my $genome_fasta = 'path/to/your/genome.fasta'; # Gene ID to extract my $gene_id_to...94 days ago