3508 days ago
How to install Perl modules manually, using CPAN command, and other quick ways
...[]Your http_proxy? []Your no_proxy? []Is it OK to try to connect to the Internet? [yes]First, pick a nearby continent and country by typing in the number(s)(1) Africa(2) Asia(3) Centr...3964 days ago
Five points for bioinformatics software/tools
...The bioinformatics company which are specializes in bioinformatics solutions develop well designed/packed, user friendly software by using a large number of specialised scientist, pro...3721 days ago
3922 days ago
3402 days ago
Detect the sequence pattern and its location in fasta file with match and mismatches information.
This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line .. To run: perl centro.pl3882 days ago
1628 days ago
3934 days ago
Bio++ : C Language libraries for your biological need
..., correlation, information theory)Classes for matrices implementation.Linear algebra: eigen decomposition, LU decomposition, inversion, etc.Random number generation: Quick & Dirty...3962 days ago
3961 days ago
3960 days ago
3956 days ago
Barber pole worm , sheep pathogen sequenced !!!
Haemonchus contortus is a highly pathogenic parasitic nematode of that can infect a large number of wild and domesticated ruminant species and is the most economically important paras...3911 days ago
OSDDlinux : Computational resources for drug discovery
...orm for designing, discovering and simulating drugs. OSDD have initiate number of projects to support in sil...mputer-aided drug design. This is a collection and compilation of large number of software and web services...3892 days ago
3963 days ago
2013 NextGen Genomics & Bioinformatics Technologies (NGBT) Conference, New Delhi, INDIA
...cing a human genome will drop to below thousand dollars. The next generation sequencing technologies over the past five years have enabled a large number of genomic studies that impac...3937 days ago
3899 days ago
3894 days ago
Des Higgins: Visualizing Multiple Sequence Alignments
...of multiple sequence alignment, and to his widely-used Clustal tool. He highlights the emerging challenge of managing alignments with a very large number of sequences, and presents se...3735 days ago
Count the frequency of base G in a given DNA sequence
...NAlength){ my $base = substr($DNA,$currentPos,1); if($base eq "G"){ $countG++; } $currentPos++; } #end of while loop #print out the number of Gs print "There are $coun...2931 days ago
Perl script to count the number of Adenine, Thymine, Guanine and Cytosine in your DNA Sequence
#!/usr/local/bin/perl -w # While executing this script it asks for the file name of the DNA sequence. If the sequence file is not available in the same directory of...2930 days ago
Will MinION Nanopore sequencing increase the number of Next Generation Sequencing projects?
Will MinION Nanopore sequencing increase the number of Next Generation Sequencing projects?3211 days ago
Tryst with a Bioinformatician # Dr Altan Kara
...stic kit for immediate clinical purposes and an electrochemical biosensor for quick on-site applications are targeted through the development of a number of antibody and aptamer forme...2376 days ago
3934 days ago
Extract the numeric values from the multiple FASTA sequence file.
I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...Tags: Extract, Number, Fasta, Coordinates
3661 days ago
Comment on "Benchmarking Perl Module !"
...e to run the benchmark. The timethese function takes two arguments: the number of iterations to run and a re...ethese function will output the results of the benchmark, including the number of iterations, the total time...429 days ago
Comment on "Short-read assembly using Spades !"
Short-read assembly is the process of constructing a genome sequence from a large number of short sequencing reads. SPAdes (St. Petersburg genome assembler) is a p...429 days ago