Download the gff files from NCBI using bash script/command
...gff # Look for genome assembly summary and extract the URL # USER need to pro...gff.gz|' > genomic_file_protozoa # -for vertebrate_mammalian curl 'ftp://ftp....+)|\1\2/\2_genomic.gff.gz|' > genomic_file_vertebrate_mammalian # -for vertebr...2517 days ago
Extract fasta sequence from a multifasta file with fasta header Ids
#!/usr/bin/perl use strict; use warnings; #Usage: perl my $list = shift @ARGV; my $fasta = shift @ARGV; my $out = shift @ARGV; my %select; open LIS...2512 days ago
2488 days ago
Compress and decompress the sequence with perl
use strict; use warnings; my @char; while () { @char = split //; } comp(\@char); #--------------------- my $com= "r0a3m4a4j0"; my @com = split //, $com; dcomp (\@com); #dcomp sub here sub dcomp { my ($com_ref)=@_; my @com=@$com_ref; my $car; for (my $aa=0; $aa2508 days ago
2463 days ago
Extract the fastq sequence with range in Perl
use Bio::DB::Fasta; open(POSITIONS,"positions.txt"); while(){ chomp; my ($seqName,$begin,$end) = split(/\s/); my $db = Bio::DB::Fasta->new('allGenomeContacted.fa'); my $seq = $db->seq("$seqName", $begin => $end); print "$seq\n"; } close(POSITIONS);2462 days ago
Genetic Algorithms demonstration with word DNA in Perl
...the DNA byte length my $mut_rate = 0.01; # the mutation rate my $min_fitness = 0.1;...size # create the weights array: select only survivors from...ual do { # select a random individual $individua...rd list at the end of the program # do the @dictionary init...2365 days ago
Extract fasta sequence with Ids with Bash script
#!/bin/bash while IFS='' read -r line || [[ -n "$line" ]]; do echo "Text read from file: $line" samtools faidx ONT.fasta $line > $line.faa done < "$1"2348 days ago
Loop over with all files in a directory in bash
#!/bin/bash FILES=/media/ComparativeGenomics/ncbi-genomes-2017-11-13/* ref=/media/ComparativeGenomics/ncbi-genomes-2017-11-13/GCA_000196735.1_ASM19673v1_genomic.fna path=/home/urbe/Tools/SATSUMA/satsuma-code...2325 days ago
Fill up the form and blast with perl
...anize; use strict; use warnings; my $mech = WWW::Mechanize->new; my $sequence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabidopsis.org/Blast/'); $mech-...2319 days ago