Results for "Results"
Bio-Scripts
Perl script to Mutate a DNA Sequence
#!/usr/local/bin/perl -w # This script randomly mutates the DNA sequence and generates 10 successive mutation results. # While executing this script it asks for the file name of t...2909 days ago
Retrieve NCBI GenBank records with a range of accession numbers
...); } message( $param{verbose}, "ESearch results could not be parsed. Resubmit...t) ) { message( $param{verbose}, "EFetch results could not be parsed. Resubmit...2909 days ago
A multilayer perceptron (MLP) neural network in Perl
#!/usr/local/bin/perl -w #################################################### #MLP neural network in Perl Original source code by Phil Brierley #Translated into pe...2909 days ago
Blast result parser with Perl and Bioperl
...top N hits of each blast search result. # For each hit, the following results are reported: # accesion num...start, query end, hit start, hit end, positives, and identical # The results are tab-deliminated and ready...2908 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
...subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[...# matched text = $& if(exists $results{$&}) {...} else { $results{$&} = 1; } } for...2902 days ago
- ...count 2:9 15 > sample_count_test.rpkm #USAGE: perl rpkm_script_beta.pl input_count_file.txt ActualColumnStart:ActualColumnEnd ColumnGeneLength > results.rpkm open $fh1, '
2865 days ago
Calculate some statistics for a DNA alignment with Perl
...y ($seq1id,$seq2id) = map { $_->display_id } $alnobj->each_seq; my $results = $stats->calc_KaKs_pair($alnobj, $seq1id, $seq2id); print "comparing ".$results->[0]{'Seq1'}." and ".$results...2642 days ago
Create genome scaffolding with Perl
#!/usr/bin/perl use warnings; use strict; use English; use Pod::Usage; ## uses pod documentation in usage code use Getopt::Long qw(:config auto_version auto_he...2302 days ago
- # Count k-mer occurrence using Jellyfish 2.2.6 jellyfish count -t 8 -C -m 19 -s 5G -o 19mer_out --min-qual-char=? sread_1.fastq sread_2.fastq # points for a histogram jellyfish histo -o 19mer_out.histo 19mer_out #Plot results using R ##load the data into dataframe19 dataframe19
2257 days ago
- ...ile --output= Directory where results are output (will be...created) (default: transrate_results) --loglevel= Lo...INFO] 2018-07-13 14:54:40 : Writing analysis results to assemblies.csv...
2116 days ago
