2705 days ago
3397 days ago
How to install Perl modules manually, using CPAN command, and other quick ways
...ies is tedious and annoying process. Some of the packages like GD is the real pain. However, Installing Perl modules using CPAN is a better solution, as it resolves all the depen...3947 days ago
Five unique traits of effective computational biologist
...te a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause..., learn enough about the underlying system to look for other clues and solutions, and learn to take a long di...3947 days ago
1100 days ago
2792 days ago
Bioinformatics approach to Boar Taint
...sm of androstenone and sex steroids share a common pathway which makes removal of boar taint a very challenging task. Castration is a traditional solution to remove boar taint but it a...3786 days ago
3941 days ago
3916 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-...3249 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome...3249 days ago
3943 days ago
Bioinformatics Companies in India
...w any specific pattern. 1. Accelrys Software Solution Pvt Ltd.12th Floor, Discover,...sh; 110 092www.labnetworx.com 18. LabVantage Solutions Pvt. Ltd.Bengal Intelligent...ics.comwww.novoinformatics.com 23. Ocimum Biosolutions (India) Ltd6th Floor, Relian...3922 days ago
3450 days ago
Roche has acquired Bina Technologies !!!
...continue to focus on development of their innovative genomic analysis solution.Roche has acquired Bina Techn...tics and data sciences are critical elements of an end-to-end genomics solution. Fast, easy-to-use, scalable,...3410 days ago
Research Assistant @ NATIONAL BUREAU OF ANIMAL GENETIC RESOURCES
...post of Research Associate under DBT sponsored Support under BIPP for the “SanGenix: A comprehensive Next Generation Sequence (NGS) data analysis solution” as Grants in AID. Thepost du...3803 days ago
Senior Bioinformatician (Assembly) Moore Aquatic Symbiosis Project Tree of Life
...ong publication record and culture of producing open data resources and open source software development. This role requires an investigative and solution-oriented mindset and excellen...943 days ago
ArrayGen Bioinformatics Genomics Group
ArrayGen is a global bioinformatics company which is a one stop solution for microarray designing and genomic...r forms of biological data. ArrayGen constantly strives to develop new solutions, and plug the existing gaps...3503 days ago
Bash script to split multifasta file !
...ze/10)+1 } /^>/ {if(n%chunksize==0){file=sprintf("chunk%d.fa",n);} print >> file; n++; next;} { print >> file; }' < multi.fasta #Another great solution is genome tools (gt), which y...820 days ago
Tryst with a Bioinformatician # Dr Altan Kara
...produced biological data to derivate unified solutions for specific biological prob...o be enlightened and it's impossible to bring solutions to this diversity by using s...totally new methods that offer an alternative solution to various biological problem...2358 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3249 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G",  ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3249 days ago
Comment on "Retrieving Taxonomic Information with R"
Perl solution to the problem https://metacpan.org/pod/Bio::Taxon1707 days ago
2134 days ago