2539 days ago
List of perl special symbols !
There are some variables which have a predefined and special meaning in Perl. They are the variables that use punctuation characters after the usual variable indicator ($, @, or %), suc...1568 days ago
2923 days ago
2707 days ago
3875 days ago
Awesome perl frameworks, libraries and software - PART 2
...erstripe-unidecode - Unidecode is a PHP version of the perl module Text::Unicode. It takes UTF-8 data and tries to represent it in US-ASCII characters. aleimba/bac-genomics-script...2503 days ago
Awesome perl frameworks, libraries and software - PART 3
...erstripe-unidecode - Unidecode is a PHP version of the perl module Text::Unicode. It takes UTF-8 data and tries to represent it in US-ASCII characters. exhuma/jsttyplay - A s...2503 days ago
Perl one-liner for bioinformatician !!!
...p {$_ % 2 == 0} 1..100; print "@even"'#Generate an array of even numbersperl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file #Convert the entire file into 13 characters offset(ROT13)perl -nle 'print...3637 days ago
2722 days ago
2 positions on the evolutionary analysis of biological sequences in Montpellier - France
...liation, comparative genomics, phylogenetic network inference and verification, phylogeography, the use of phylogenies to study the evolution of characters. A one thousand year old...3151 days ago
Find and replace ambiguous characters in fasta file with Perl and Bioperl
...-m: missing character\n". "Print out the name of sequences with characters other than ATGC-.\n". "If -m is specified, the ambiguous characters are repleced with the\n"....2923 days ago
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...2918 days ago
Special Nucleotide Characters / Symbols !
Nucleotide symbols Nucleotide symbol Full Name A Adenine C Cytosine G Guanine T Thymine U Uracil R Guanine / Adenine (purine) Y Cytosine / Thymine (pyrimidine) K Guanine / Thymine M Adenine / Cytosine S Guanine / Cytosine W ...Tags: nucleotide, special, characters, symbols
879 days ago