BOL: Results for "characters"

Results for "characters"

- Jit@jit.aber
Ancestral sequence reconstruction (ASR) or ancestral gene/sequence reconstruction/resurrection tools to study molecular evolution
...cestral indel states assuming a continuous time Markov process. FastML provides the most likely ancestral sequences, integrating both indels and characters; (ii) FastML accounts for unc...
2539 days ago
- Jit@jit.aber
List of perl special symbols !
There are some variables which have a predefined and special meaning in Perl. They are the variables that use punctuation characters after the usual variable indicator ($, @, or %), suc...
1568 days ago
+3 more Blogs

- Radha Agarkar@radhaagarkar
cutadapt
...or primer sequences in an error-tolerant way. It can also modify and filter reads in various ways. Adapter sequences can contain IUPAC wildcard characters. Also, paired-end reads and e...
2923 days ago
- Bulbul@bulbul
Cutadapt
...or primer sequences in an error-tolerant way. It can also modify and filter reads in various ways. Adapter sequences can contain IUPAC wildcard characters. Also, paired-end reads and e...
2707 days ago
+4 more Bookmarks

- Jit@jit.aber
Clean the FASTA file
Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.
3875 days ago

- Abhimanyu Singh@abhimanyu
Perl one-liner for bioinformatician !!!
...p {$_ % 2 == 0} 1..100; print "@even"'#Generate an array of even numbersperl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file #Convert the entire file into 13 characters offset(ROT13)perl -nle 'print...
3637 days ago
- Jit@jit.aber
BBMap/BBTools package: Multipurpose tool designed for converting reads or other nucleotide data between different formats.
...ional flag "-Xmx2g". For example, to change the line-wrapping length on the human genome (which has individual sequences over 200Mbp long) to 70 characters: reformat.sh -Xmx2g in=HG19.f...
2722 days ago
+8 more Top-level pages

- Jit@jit.aber
Find a pattern in first 7 characters of reads. bioawk -c fastx 'substr($seq,0,7) == $TAG { print }' reads.fq.gz #Reads #NGS #Extract #Pattern
2510 days ago
- Jit@jit.aber
Remove four beginning characters from each line of the file. $ sed 's/^....//' genbank.txt #Remove #Sed #Text
2514 days ago
+2 more Wire posts

- Rahul Nayak@rahul
2 positions on the evolutionary analysis of biological sequences in Montpellier - France
...liation, comparative genomics, phylogenetic network inference and verification, phylogeography, the use of phylogenies to study the evolution of characters. A one thousand year old...
3151 days ago

- Radha Agarkar@radhaagarkar
Find and replace ambiguous characters in fasta file with Perl and Bioperl
...-m: missing character\n". "Print out the name of sequences with characters other than ATGC-.\n". "If -m is specified, the ambiguous characters are repleced with the\n"....
2923 days ago
- Jit@jit.aber
Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl
#!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...
2918 days ago
+2 more Bio-Scripts