BBTools for bioinformatician !
...Code: ACCGTTACCGTTACCGTTAC 100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should be pretty obvious. Convert SAM format from 1.4 to 1.3 (r...2271 days ago
2160 days ago
3009 days ago
2867 days ago
2151 days ago
Bio++ : C Language libraries for your biological need
...as possible, and retain its spirit and efficiency. It was possible to convert from C to C++ gradually, thus...d names, testing existence, open and store in string arrays, etc.Text: convert text to any other type and vi...3948 days ago
Genome Assembly Tools and Software - PART2 !!
...p Assembly problemATLAS GapFill deals with the repetitive gap assembly problem by using the unique gap-flanking sequences to group reads and convert the problem to a local assemb...2686 days ago
Perl one-liner for bioinformatician !!!
...spacing, numbering lines, doing calculations, converting and substituting text, del...00, 105, 110, 103); print pack("C*", @ascii)'#converts ascii values into character...)/\u$1/g' #Camel Casingperl -pe 's|\n|\r\n|' #Convert unix new lines into DOS new l...3628 days ago
2714 days ago
SRF/JRF Bioinformatics at CIARI
...ands. The ultimate aim of CIARI is the developments of island agricultural production technologies which utilizes the strengths of the island and convert the constraints in opportunit...3075 days ago
Translational Bioinformatics: Transforming 300 Billion Points of Data
...well described. The nascent field of translational bioinformatics may help. Dr. Butte's lab at Stanford University builds and applies tools that convert more than 300 billion points...3911 days ago
BioPerl to convert between sequence formats from Fasta to Genbank
#!/usr/local/bin/perl -w # Sequence formats to choose: Fasta, EMBL. GenBank, Swissprot, PIR and GCG use Bio::SeqIO; $inFile = "BRCA2.fa"; $in = Bio::SeqIO-...2916 days ago
Convert newline formated sequence into fasta format with perl
use strict; use warnings; my $filename = $ARGV[0]; open(my $fh, '2370 days ago
Comment on "Tools for Sequence translation !"
Sequence translation is the process of converting a DNA or RNA sequence into its corresp...several genetic codes and can also perform reverse translation (i.e., convert a protein sequence into its c...421 days ago
Comment on "Run miniasm assembler on nanopore reads !"
...\ /home/data/20170911_oly_pacbio_cat.fastq /home/data/20170911_minimap2_pacbio_oly.paf > /home/data/20170918_oly_pacbio_miniasm_reads.gfa 3 Convert miniasm output GFA to FASTA...2167 days ago