Results for "number"

Users

  • RaghavaGPS

    About me: ...es in the field of computer-aided drug/vaccine design (probably highest number of services developed/maintai...ndex 91 as per google scholar. In addition group contributed/maintained number of web sites that include i) ...

    3520 days ago

Blogs

Bookmarks

  • Look up a biological numbers

    Did you ever need to look up a number like the volume of a cell or the cellula...ifficult it can be to find concrete biological numbers, even for properties that ha...times. To help solve this for one and all, BioNumbers (the database of key numbers...

    3934 days ago

  • ChromEvol

    Chromosome number is a remarkably dynamic feature of eukaryotic evolution. Chromosome numbers can change by a duplication...he various mechanisms of chromosome number change, polyploidy has receiv...els for the evolution of chromosome numbers. By comparing the fit of the...

    3414 days ago

  • +100 more Bookmarks

Files

Discussion topics

  • Compressive Genomics

    The key to finding a solution is to notice that most genomicsequences differ by very little. It may well be that the number of complete genome sequences being stored is increasin...

    3946 days ago

Pages

Top-level pages

Wire posts

News

Opportunity posts

ResearchLabs posts

  • SOWDHAMINI Lab

    ...hese proteins' higher-level structure and function. The most productive way to indirectly exploit these databases has been to start with the small number of proteins that are fully-ch...

    3911 days ago

  • Pandey Lab

    ...us "Omics" technologies including genomics and proteomics to understand signaling pathways and to identify therapeutic targets and biomarkers in a number of cancers. More at http:/...

    3905 days ago

  • +5 more ResearchLabs posts

Video

Bio-Scripts

Polls

Tryst

Groups

  • Ruby and BioRuby

    Ruby and BioRuby

    ...es for DNA and protein sequence analysis, alignment, database parsing, tools for structural biology, and other Bioinformatics. BioRuby is one of a number of Bio* projects designed to...

    3946 days ago

Tags

  • Extract the numeric values from the multiple FASTA sequence file.

    I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...

    Tags: Extract, Number, Fasta, Coordinates

    3672 days ago

  • Count the total number of lines in a file. my $total=@{[<INFILE>]}; #Perl #Count #Number #Total #File

    Tags: Perl, Count, Number, Total, File

    3643 days ago

  • +10 more Tags

Comments