3520 days ago
How to install Perl modules manually, using CPAN command, and other quick ways
...[]Your http_proxy? []Your no_proxy? []Is it OK to try to connect to the Internet? [yes]First, pick a nearby continent and country by typing in the number(s)(1) Africa(2) Asia(3) Centr...3976 days ago
Five points for bioinformatics software/tools
...The bioinformatics company which are specializes in bioinformatics solutions develop well designed/packed, user friendly software by using a large number of specialised scientist, pro...3733 days ago
3934 days ago
3414 days ago
Detect the sequence pattern and its location in fasta file with match and mismatches information.
This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line .. To run: perl centro.pl3893 days ago
1640 days ago
3946 days ago
Bio++ : C Language libraries for your biological need
..., correlation, information theory)Classes for matrices implementation.Linear algebra: eigen decomposition, LU decomposition, inversion, etc.Random number generation: Quick & Dirty...3973 days ago
3973 days ago
3972 days ago
3968 days ago
Barber pole worm , sheep pathogen sequenced !!!
Haemonchus contortus is a highly pathogenic parasitic nematode of that can infect a large number of wild and domesticated ruminant species and is the most economically important paras...3922 days ago
OSDDlinux : Computational resources for drug discovery
...orm for designing, discovering and simulating drugs. OSDD have initiate number of projects to support in sil...mputer-aided drug design. This is a collection and compilation of large number of software and web services...3903 days ago
3974 days ago
2013 NextGen Genomics & Bioinformatics Technologies (NGBT) Conference, New Delhi, INDIA
...cing a human genome will drop to below thousand dollars. The next generation sequencing technologies over the past five years have enabled a large number of genomic studies that impac...3948 days ago
3911 days ago
3905 days ago
Des Higgins: Visualizing Multiple Sequence Alignments
...of multiple sequence alignment, and to his widely-used Clustal tool. He highlights the emerging challenge of managing alignments with a very large number of sequences, and presents se...3747 days ago
Count the frequency of base G in a given DNA sequence
...NAlength){ my $base = substr($DNA,$currentPos,1); if($base eq "G"){ $countG++; } $currentPos++; } #end of while loop #print out the number of Gs print "There are $coun...2943 days ago
Perl script to count the number of Adenine, Thymine, Guanine and Cytosine in your DNA Sequence
#!/usr/local/bin/perl -w # While executing this script it asks for the file name of the DNA sequence. If the sequence file is not available in the same directory of...2942 days ago
Will MinION Nanopore sequencing increase the number of Next Generation Sequencing projects?
Will MinION Nanopore sequencing increase the number of Next Generation Sequencing projects?3223 days ago
Tryst with a Bioinformatician # Dr Altan Kara
...stic kit for immediate clinical purposes and an electrochemical biosensor for quick on-site applications are targeted through the development of a number of antibody and aptamer forme...2388 days ago
3946 days ago
Extract the numeric values from the multiple FASTA sequence file.
I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...Tags: Extract, Number, Fasta, Coordinates
3672 days ago
Comment on "Benchmarking Perl Module !"
...e to run the benchmark. The timethese function takes two arguments: the number of iterations to run and a re...ethese function will output the results of the benchmark, including the number of iterations, the total time...441 days ago
Comment on "Short-read assembly using Spades !"
Short-read assembly is the process of constructing a genome sequence from a large number of short sequencing reads. SPAdes (St. Petersburg genome assembler) is a p...441 days ago