BOL: Results for "primers"

Results for "primers"

- Surabhi Chaudhary@surabhi
BBTools for bioinformatician !
...-----Reformat.sh Count k-mers/find unknown primers Code: $ reforma...00 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should be...e is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be short...
2281 days ago
- BioStar@biostar
Bioinformatics tools to explore SSRs in genomes !
...ious organisms and can identify perfect, compound, and imperfect SSRs. Primer3: Primer3 is a web-based tool that designs PCR primers for SSRs. It can design primers for perfect and imperfect SSR...
435 days ago
+1 more Blogs

- Rahul Nayak@rahul
Bioinformatics Protocols
...s and DNA. Amplicons Protocol Amplicon Alignment In this protocol we discuss and outline the process of aligning custom amplicons using primers for high precision. Learn G...
3663 days ago
- LEGE@lege
CoronaVIR: Computational Resources on Novel Coronavirus (SARS-CoV-2 or COVID-19)
...appropriate literature. Moreover, we are Bioinformatics Group, based on our knowledge and expertise, we are also proposing potential diagnostics primers, peptide and RNA based vaccin...
1114 days ago
+8 more Bookmarks

- Jit@jit.aber
Genome Assembly Tools and Software - PART1 !!
...DASEQ 2.8 / Pandaseq-sam 1.3 – PAired-eND Assembler for DNA sequences PANDASEQ is a program to align Illumina reads, optionally with PCR primers embedded in the sequence, and...
2696 days ago

- BioStar@biostar
Primer BLAST !
...Max 3' match), shown in Figure 1, to Primer-BLAST that limits the length of 3' exon matches when designing exon-exon spanning primers. This makes it less likely that primers specifically designed to ampl...
1478 days ago

- Radha Agarkar@radhaagarkar
Primer Design for PCR
In this lecture, I explain how to design working primers for use in PCR. If you are unfamiliar with PCR, watch the following video: http://www.youtube.com/watch?v=2KoLnIwoZKU. Created by:Tyler Maxfield
3900 days ago