Results for "solution"

Users

Blogs

Bookmarks

  • Bioinformatics in Thailand !

    ...echniques and modeling, and data integration. Each student will apply their skills to a practical project, where they will design and implement a solution to a real-world problem under...

    1116 days ago

  • FERMI

    ...es a tool to fix misassemblies by using paired-end reads to achieve an accuracy comparable to other assemblers, this is not a favorable solution.Fermi is designed to be used...

    2808 days ago

  • +9 more Bookmarks

Files

Discussion topics

Pages

Top-level pages

  • Bioinformatics Algorithms

    ...ocess whereas non-deterministic algorithm must perform guesses of best solution at each step through the use...nd conquer algorithm, that solves an identical subproblem and uses the solution of this subproblem to solve t...

    3959 days ago

  • Bioinformatics Companies in India

    ...w any specific pattern. 1. Accelrys Software Solution Pvt Ltd.12th Floor, Discover,...sh; 110 092www.labnetworx.com 18. LabVantage Solutions Pvt. Ltd.Bengal Intelligent...ics.comwww.novoinformatics.com 23. Ocimum Biosolutions (India) Ltd6th Floor, Relian...

    3938 days ago

  • +4 more Top-level pages

News

  • translate2R

    ...onference, data analysis specialist eoda starts the public alpha testing of translate2R. With the start of alpha testing the innovative migration solution by the company hailing from K...

    3466 days ago

  • Roche has acquired Bina Technologies !!!

    ...continue to focus on development of their innovative genomic analysis solution.Roche has acquired Bina Techn...tics and data sciences are critical elements of an end-to-end genomics solution. Fast, easy-to-use, scalable,...

    3427 days ago

  • +2 more News

Opportunity posts

ResearchLabs posts

Bio-Scripts

Tryst

  • Tryst with a Bioinformatician # Dr Altan Kara

    ...produced biological data to derivate unified solutions for specific biological prob...o be enlightened and it's impossible to bring solutions to this diversity by using s...totally new methods that offer an alternative solution to various biological problem...

    2375 days ago

Tags

  • Frequent words problem solution by Perl

    Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    3265 days ago

  • Reverse Complement Problem Solved with Perl

    Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = (    "C" => "G",   ...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary

    3265 days ago

  • +7 more Tags

Comments